ID: 979427853

View in Genome Browser
Species Human (GRCh38)
Location 4:120590105-120590127
Sequence GAGCTTGCACTATGAATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979427853_979427859 13 Left 979427853 4:120590105-120590127 CCACCAATTCATAGTGCAAGCTC No data
Right 979427859 4:120590141-120590163 TCTCTACTGCTATTACAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979427853 Original CRISPR GAGCTTGCACTATGAATTGG TGG (reversed) Intergenic
No off target data available for this crispr