ID: 979427859

View in Genome Browser
Species Human (GRCh38)
Location 4:120590141-120590163
Sequence TCTCTACTGCTATTACAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979427852_979427859 14 Left 979427852 4:120590104-120590126 CCCACCAATTCATAGTGCAAGCT No data
Right 979427859 4:120590141-120590163 TCTCTACTGCTATTACAACATGG No data
979427850_979427859 28 Left 979427850 4:120590090-120590112 CCTGAGTGTCCTTTCCCACCAAT No data
Right 979427859 4:120590141-120590163 TCTCTACTGCTATTACAACATGG No data
979427854_979427859 10 Left 979427854 4:120590108-120590130 CCAATTCATAGTGCAAGCTCCAC No data
Right 979427859 4:120590141-120590163 TCTCTACTGCTATTACAACATGG No data
979427851_979427859 19 Left 979427851 4:120590099-120590121 CCTTTCCCACCAATTCATAGTGC No data
Right 979427859 4:120590141-120590163 TCTCTACTGCTATTACAACATGG No data
979427855_979427859 -9 Left 979427855 4:120590127-120590149 CCACCTCCCTACTTTCTCTACTG No data
Right 979427859 4:120590141-120590163 TCTCTACTGCTATTACAACATGG No data
979427853_979427859 13 Left 979427853 4:120590105-120590127 CCACCAATTCATAGTGCAAGCTC No data
Right 979427859 4:120590141-120590163 TCTCTACTGCTATTACAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979427859 Original CRISPR TCTCTACTGCTATTACAACA TGG Intergenic
No off target data available for this crispr