ID: 979431228

View in Genome Browser
Species Human (GRCh38)
Location 4:120634079-120634101
Sequence CCAGAAATCCACATGTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979431225_979431228 -2 Left 979431225 4:120634058-120634080 CCAATTGAGTAAATGGAGATCCC No data
Right 979431228 4:120634079-120634101 CCAGAAATCCACATGTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979431228 Original CRISPR CCAGAAATCCACATGTATAT AGG Intergenic
No off target data available for this crispr