ID: 979437721

View in Genome Browser
Species Human (GRCh38)
Location 4:120713898-120713920
Sequence GTGAATTCCCTGTCCTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979437719_979437721 -9 Left 979437719 4:120713884-120713906 CCCTTTTCTGGGTTGTGAATTCC 0: 1
1: 0
2: 0
3: 24
4: 283
Right 979437721 4:120713898-120713920 GTGAATTCCCTGTCCTCACATGG 0: 1
1: 0
2: 1
3: 29
4: 253
979437720_979437721 -10 Left 979437720 4:120713885-120713907 CCTTTTCTGGGTTGTGAATTCCC 0: 1
1: 0
2: 0
3: 19
4: 200
Right 979437721 4:120713898-120713920 GTGAATTCCCTGTCCTCACATGG 0: 1
1: 0
2: 1
3: 29
4: 253
979437716_979437721 13 Left 979437716 4:120713862-120713884 CCTAGTCAGGTTCACATGAGGGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 979437721 4:120713898-120713920 GTGAATTCCCTGTCCTCACATGG 0: 1
1: 0
2: 1
3: 29
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979437721 Original CRISPR GTGAATTCCCTGTCCTCACA TGG Intronic
901884992 1:12216528-12216550 GTCAATTCCCTGCTCTCAAAGGG - Intergenic
902521475 1:17020180-17020202 GTGTATTTCCGGTCCCCACAGGG + Intronic
902648191 1:17818745-17818767 TTGAGTTCCCTGTCCTTACCAGG + Intronic
903569288 1:24292492-24292514 GTGAGGTCCCTGTCCTGCCAGGG - Intergenic
905451984 1:38062858-38062880 GTGCATTTCCTCTCCTCACCAGG + Intergenic
905665067 1:39758743-39758765 GAGAATTCCCTATCAGCACAGGG - Exonic
906892613 1:49733767-49733789 GTGAAATCTTTGTCCCCACATGG - Intronic
908260020 1:62333097-62333119 TTTAATTCTGTGTCCTCACATGG - Intergenic
908347112 1:63245372-63245394 GTGAACACTGTGTCCTCACATGG + Intergenic
908779015 1:67671467-67671489 GTGGATTCAGTGTCTTCACATGG - Intergenic
910428133 1:87135738-87135760 GTGAATTCACTGTGCTCTCTGGG + Intronic
910838729 1:91541273-91541295 GTGACTTGCCTGTGGTCACATGG + Intergenic
911108283 1:94155509-94155531 GTGAATGCTATGTCCTCACATGG - Intronic
913050295 1:115111671-115111693 GTGCCTTCTGTGTCCTCACATGG - Intergenic
915081172 1:153353740-153353762 GTCAGGTCCCTCTCCTCACAGGG - Intergenic
915663117 1:157420074-157420096 GGGAATGCCGTGTCCTCACATGG - Intergenic
916150575 1:161784967-161784989 GTAACTTCCCAGTCCTTACAAGG + Intronic
917816017 1:178711224-178711246 GTGAATTCCCTTTCCAGGCAAGG + Intergenic
918338857 1:183550481-183550503 ATGAATGCCCTATTCTCACACGG - Intronic
919170780 1:193951043-193951065 GTTTTTTCTCTGTCCTCACATGG - Intergenic
920066859 1:203275281-203275303 GTGACTTCCCTGTCTACAGAAGG + Intergenic
920648598 1:207820927-207820949 CTCACTTCCCTGTCCCCACAGGG + Intergenic
921546934 1:216484297-216484319 GAAAATTCCATGTCCTCACTAGG + Intergenic
921570483 1:216772279-216772301 GTGAATTTCCAGTCCTAAAACGG + Intronic
921932983 1:220770467-220770489 GTGAATGACCTCTCCTTACAAGG - Intronic
922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG + Intergenic
922454266 1:225762224-225762246 GTGAATTTCCAGACCTCAGAGGG - Intergenic
922824776 1:228510261-228510283 GGCAGGTCCCTGTCCTCACATGG - Intergenic
923659125 1:235943418-235943440 GTCTTTTCCGTGTCCTCACAAGG - Intergenic
924440560 1:244082167-244082189 ATGCCTTCCCTGACCTCACAGGG - Intergenic
1065510949 10:26478043-26478065 GTCAAATCCCTGCCCTCACCGGG + Intronic
1070528247 10:77313399-77313421 GTGAAGGCCCTGTCCCCTCATGG - Intronic
1071380463 10:85053957-85053979 CTCAATTCCCAGTCCTCTCATGG + Intergenic
1071681313 10:87708375-87708397 GTGAAGTCCCTGAACACACAGGG - Intronic
1074289630 10:112128612-112128634 GAGAATCACCTGACCTCACATGG + Intergenic
1075415439 10:122259085-122259107 TTCCACTCCCTGTCCTCACAAGG - Intergenic
1080038801 11:27737282-27737304 ATGAAGTCCCTGCCTTCACAGGG - Intergenic
1080437243 11:32256415-32256437 GTGAATTGCATGTCTTCATAAGG - Intergenic
1080756512 11:35205322-35205344 GTGAATTCCATATTCTCACTTGG + Intronic
1081337086 11:41880082-41880104 GTGAACACTATGTCCTCACATGG - Intergenic
1081407940 11:42719655-42719677 ATGAACTCTGTGTCCTCACATGG + Intergenic
1081447255 11:43142591-43142613 GAGGATTCCCAGTGCTCACAGGG + Intergenic
1081489712 11:43557977-43557999 GTGACCTCCCTATCGTCACATGG - Intronic
1081515801 11:43828072-43828094 GTGAAATCCTTGTCCTTGCAGGG - Intronic
1082039296 11:47671729-47671751 CCCAATTCCCTGTTCTCACAAGG + Intronic
1084082579 11:66838270-66838292 GTGGCTTCACTGACCTCACAAGG - Intronic
1086163767 11:83753004-83753026 GTAAATTCACTGTCCCCTCAAGG - Intronic
1087140346 11:94759649-94759671 GTGAATTACCTGAGATCACATGG - Intronic
1087160765 11:94946089-94946111 GGGAATGCTGTGTCCTCACACGG + Intergenic
1088711288 11:112511236-112511258 CTGAATTCCCTGGCCTCTCAGGG - Intergenic
1089238751 11:117055861-117055883 TTGAATGCTGTGTCCTCACATGG - Intronic
1090196254 11:124819003-124819025 GTGACTGCTCTGTCCTCACACGG - Intergenic
1091412950 12:256196-256218 ACCAATTCCCTGTCCTCATAGGG - Intronic
1091616686 12:2054934-2054956 GTGAAGGCCCTGTCCCCAAAAGG - Intronic
1092112673 12:5975004-5975026 GTTATTTCCCTGGCCTCAGATGG + Intronic
1094390820 12:29948663-29948685 GAGAATACTGTGTCCTCACATGG + Intergenic
1094625210 12:32117155-32117177 ATGAATTCCCTGTCACCAAAAGG + Intronic
1095294680 12:40514589-40514611 AGGAATTCCCTGGCCTCACCTGG + Intronic
1096921604 12:55092941-55092963 GTAAATTCTCTATTCTCACATGG - Intergenic
1097427913 12:59470286-59470308 ATGCATGCCATGTCCTCACATGG + Intergenic
1098451089 12:70618723-70618745 GTGGATTGCGTGTCTTCACAAGG - Intronic
1098994744 12:77106062-77106084 CTTAATTCCCTGTCCCAACATGG - Intergenic
1100601368 12:96114186-96114208 GGAAATTCCCTGTCCTCCCTGGG - Intergenic
1101540488 12:105660536-105660558 GTGAACTCTGTGTCCTCACATGG + Intergenic
1103858925 12:123996094-123996116 GTGCATTCCCTGTACTTACCAGG + Intronic
1105587226 13:21756489-21756511 GGGACTTCACTGCCCTCACAAGG + Intergenic
1105904311 13:24790742-24790764 TTGAATGCTGTGTCCTCACATGG + Intronic
1108379489 13:49842435-49842457 ATGAATGCTGTGTCCTCACATGG - Intergenic
1111110593 13:83703769-83703791 GTAAAATCTCTCTCCTCACATGG - Intergenic
1111660829 13:91208600-91208622 GTGAATTCCATGGCCTCCCTAGG + Intergenic
1113210620 13:107975534-107975556 GTGATCTCCCTGTCTCCACATGG - Intergenic
1114040603 14:18674741-18674763 CTGGATTCTCAGTCCTCACATGG + Intergenic
1114045641 14:18873252-18873274 CTGGATTCTCAGTCCTCACATGG + Intergenic
1114118570 14:19646216-19646238 CTGGATTCTCAGTCCTCACATGG - Intergenic
1115373874 14:32651607-32651629 GTGAACTCTGTGTCCTCACATGG + Intronic
1115464717 14:33702522-33702544 GTCAATCCACTTTCCTCACATGG - Intronic
1116159740 14:41253494-41253516 GTTGTTTCCCTGTCCTCCCATGG - Intergenic
1116334026 14:43634296-43634318 ATGAATTCTGTGTCCTCACGTGG + Intergenic
1116571176 14:46517531-46517553 ATTAATTCCTTGTCATCACATGG - Intergenic
1117720240 14:58622193-58622215 TAGAATACCCTGTCCTCCCAGGG - Intergenic
1118331889 14:64821775-64821797 GTGGATTCCTTGTCATGACAAGG + Intronic
1119140588 14:72263676-72263698 GTGTCTTCTGTGTCCTCACATGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122423743 14:101593442-101593464 GTGAATTCCCTGAAGTCTCAGGG + Intergenic
1122671077 14:103372865-103372887 GACAAATCCCTGACCTCACATGG - Intergenic
1127217484 15:56839212-56839234 GTAAATTCCTTGTGTTCACAGGG + Intronic
1129268550 15:74407772-74407794 CTGAGTTCCCTGTCCTCTCTGGG - Intergenic
1130041803 15:80411273-80411295 ATACATTCCCTGCCCTCACAGGG - Intronic
1131106137 15:89736262-89736284 GTGATTCCCCAGTCCTTACAGGG + Intronic
1132034398 15:98469178-98469200 ATGAATGCCGTGTCCTCACATGG - Intronic
1132182044 15:99762766-99762788 GTGTATTCTGTGTCCTCACCTGG - Intergenic
1132246322 15:100298987-100299009 GTCACCTTCCTGTCCTCACAGGG + Intronic
1133487470 16:6234025-6234047 AAGAATGCCGTGTCCTCACATGG + Intronic
1133616638 16:7483040-7483062 GTGGCTTCCCTCTCCTCCCACGG - Intronic
1137715215 16:50594418-50594440 CTGCAGTCCCTGACCTCACAGGG - Intronic
1140697133 16:77546418-77546440 GTGGATTCCAGGTCCTCATAAGG - Intergenic
1141564877 16:84894531-84894553 GAAAAATCCCTGTCCTCATAGGG + Intronic
1141987830 16:87591317-87591339 CTGTATTCCCTGTCCTCACAGGG + Intergenic
1143725035 17:8838847-8838869 GGGAATTCACTGTCCACAAAGGG - Intronic
1144080206 17:11757524-11757546 CTGTATTCTCTGTGCTCACAGGG + Exonic
1147794292 17:43031633-43031655 TTGCATTCCCTGAGCTCACATGG - Intergenic
1148873950 17:50675635-50675657 CTGAGTGCCCTGTCCTCAGATGG + Exonic
1149249418 17:54750779-54750801 GTGAATGCTATGTCCTCACATGG - Intergenic
1149572699 17:57684956-57684978 GTTTATTCCCTGTCCACTCATGG - Intergenic
1149937713 17:60825688-60825710 TTGAACTCCATGTCCTCACATGG + Intronic
1152127663 17:78456962-78456984 GTGCCTTTCCTGTTCTCACAGGG - Intronic
1152462290 17:80447884-80447906 GTGAGTTCCCTGTCCCCAGAAGG + Intergenic
1153073763 18:1137899-1137921 TTGAATGCTGTGTCCTCACATGG + Intergenic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1156721264 18:40072888-40072910 AGGAATGCCGTGTCCTCACATGG + Intergenic
1157436883 18:47677883-47677905 ATGAATCCTGTGTCCTCACATGG + Intergenic
1157514278 18:48299753-48299775 GTGAACTCTCTCTCCCCACAGGG - Intronic
1157600180 18:48888878-48888900 AGGAATGCCGTGTCCTCACATGG + Intergenic
1158767255 18:60468013-60468035 GTGAATTTCCTTTCCTCTCAGGG + Intergenic
1164527134 19:29020733-29020755 GTGAATTCTCTGAGCTCACTTGG - Intergenic
1167453871 19:49588349-49588371 GTGAATTTCCTGAGGTCACAGGG + Intronic
925078110 2:1036883-1036905 ATGAATGCCCTGTTCTCACCAGG - Intronic
926936765 2:18093703-18093725 GTGAAGTCCCTGTCTTCATGGGG - Intronic
927482149 2:23462516-23462538 GAGAATTCTCTGTCCTACCACGG - Intronic
928262898 2:29783766-29783788 GTAACATCCCTGTCCTCACTGGG + Intronic
928844128 2:35648706-35648728 GTGAATTCTGTATTCTCACAGGG + Intergenic
930120721 2:47758488-47758510 GTGACTTCCGTGTCCACCCAGGG + Intronic
930420207 2:51141921-51141943 TTGTATTCCCTTTCCTCAGAAGG + Intergenic
930511491 2:52350774-52350796 TTGAATGCTGTGTCCTCACATGG - Intergenic
930868209 2:56143044-56143066 GGGAATTCCCTTTCCTGCCAAGG - Intergenic
931084048 2:58809209-58809231 ATGAATTACCTCTCCTCAGAGGG - Intergenic
932842016 2:75092209-75092231 CTGAGTTGCCTTTCCTCACACGG + Intronic
937847879 2:126601487-126601509 CTGAACTCTCTGTCTTCACATGG + Intergenic
938269582 2:129957805-129957827 CTGGATTCTCAGTCCTCACATGG - Intergenic
938977029 2:136489047-136489069 TTGGATTCCATGTCCTCAGATGG - Intergenic
939122009 2:138128682-138128704 ATGATTTCCCTGCTCTCACAAGG + Intergenic
939744502 2:145952117-145952139 GGGAATTCCCTTTCCTACCAAGG - Intergenic
939988445 2:148855137-148855159 GTGAATGCTGTGTCCTCATATGG - Intergenic
943174790 2:184456969-184456991 ATGAATTCCCTTTCCTCAGCTGG - Intergenic
943934519 2:193898449-193898471 ATGAATGCTCTGTCCTCACATGG - Intergenic
944167087 2:196734521-196734543 CTGAATGCTGTGTCCTCACATGG - Intronic
944280856 2:197894860-197894882 ATGAATCCCCTATCCTCACTTGG - Intronic
946495063 2:220188163-220188185 ATAAATTCCCTGTCACCACAGGG - Intergenic
947235103 2:227933223-227933245 TTGAATTCCCTGACCACACGTGG - Intergenic
947295606 2:228627262-228627284 GTCAAATCCCTGTCATCCCATGG - Intergenic
1169830833 20:9823147-9823169 ATGAATGCTGTGTCCTCACATGG - Intronic
1170471928 20:16676283-16676305 ATGAATGCTGTGTCCTCACATGG - Intergenic
1170503108 20:16995299-16995321 CTGAATTCTGTGTCCTCACATGG - Intergenic
1172883424 20:38216331-38216353 GAGAGTGCCCTGTCCTCCCAGGG + Intronic
1173293027 20:41730961-41730983 GTGAATCCCCAATCTTCACATGG - Intergenic
1173295421 20:41751099-41751121 ATGAATGCTGTGTCCTCACATGG - Intergenic
1173364809 20:42375486-42375508 TTGAATGCCATGTCCTCATATGG - Intronic
1174723417 20:52837516-52837538 GTGAACAGACTGTCCTCACAGGG + Intergenic
1175285701 20:57835328-57835350 GTGCACTCCCTGACCTCACTGGG - Intergenic
1176268927 20:64225333-64225355 ATGACTTCCCTGTCCGCACCTGG + Intronic
1177103613 21:16926072-16926094 TTAAATACCATGTCCTCACATGG - Intergenic
1177549827 21:22606188-22606210 GTGAATTTCCTCTCCTCTTAAGG + Intergenic
1178027812 21:28488177-28488199 GGGAATTCCTTCTCCTAACAAGG - Intergenic
1179287032 21:39986305-39986327 GTGAATGCTGTGTCCTCACATGG - Intergenic
1180464172 22:15595869-15595891 CTGGATTCTCAGTCCTCACATGG + Intergenic
1181975715 22:26727930-26727952 GTGAACTCTGTGTCCTCACATGG + Intergenic
1184300402 22:43555459-43555481 GTTCATTCCCTGGCCTCTCAGGG - Intronic
1185073781 22:48671655-48671677 GAGAATCCCCTGGCCTCCCAGGG + Intronic
949303277 3:2609318-2609340 TTGAATACCGTGTCCTCACATGG - Intronic
949578685 3:5364377-5364399 ATGAATTCTGTGTCCTCACATGG - Intergenic
952794700 3:37228380-37228402 AAGAATTGCCTGTCCTCCCAAGG - Intergenic
956564971 3:70626001-70626023 GGGAATGCTGTGTCCTCACATGG - Intergenic
959403914 3:105937301-105937323 AGGAATACCATGTCCTCACATGG - Intergenic
959540481 3:107531841-107531863 GAGAATGCCCTGTGCTGACAAGG - Intronic
959979826 3:112503581-112503603 ATGAATGCTGTGTCCTCACATGG - Intergenic
962620998 3:137178823-137178845 ATGAATGCTGTGTCCTCACATGG + Intergenic
967570592 3:191023659-191023681 ATGAATACCATGTCCTCGCATGG - Intergenic
967733435 3:192927602-192927624 CAGAAATCCCTCTCCTCACAGGG + Intergenic
967959752 3:194911060-194911082 GGGAATGCTGTGTCCTCACATGG + Intergenic
969271047 4:6102470-6102492 TTGAATGCCATGTCCTCACATGG - Intronic
969617503 4:8262214-8262236 GTGGATTCCCTGCCCCCAAAGGG - Intergenic
969863137 4:10053291-10053313 GTGGATCCACTGTCATCACAAGG + Intronic
970870135 4:20807337-20807359 GTGAAGACCCTGTAATCACATGG + Intronic
970871283 4:20819782-20819804 ATGAATGCTGTGTCCTCACATGG - Intronic
971044695 4:22792337-22792359 TGGATTTCCCTGTCTTCACATGG - Intergenic
972887228 4:43507629-43507651 TTGAATGTTCTGTCCTCACATGG - Intergenic
973586115 4:52393225-52393247 TCTAAATCCCTGTCCTCACAGGG - Intergenic
977124530 4:93148748-93148770 ACAAAATCCCTGTCCTCACAGGG - Intronic
977676016 4:99747889-99747911 ATGAATGCTGTGTCCTCACATGG - Intergenic
977775537 4:100915153-100915175 TTGAATGCTGTGTCCTCACATGG - Intergenic
979437721 4:120713898-120713920 GTGAATTCCCTGTCCTCACATGG + Intronic
981377560 4:144033426-144033448 ATGAATACTGTGTCCTCACATGG - Intergenic
981687805 4:147474598-147474620 ATGAATGCTCTGTCCTCACATGG + Intergenic
982294924 4:153817975-153817997 GTAAATGCCATGTCCTCACGTGG - Intergenic
983433132 4:167676504-167676526 GTGAACTCTATGTCCTTACATGG - Intergenic
983703892 4:170633705-170633727 GTGAAGTTCCTGCCCTCATAAGG - Intergenic
983731287 4:170996868-170996890 GTGAGTTCTCTATTCTCACATGG + Intergenic
984523756 4:180831673-180831695 GTGAATGCTGTGTCCTCACATGG + Intergenic
985018415 4:185661483-185661505 CTGAATTCCTAGTCCTCAGAGGG + Intronic
985512551 5:320893-320915 CTGAATTCCCTGTACCCTCAGGG - Intronic
986719054 5:10547130-10547152 GGGAATTCCCTTCCCTCCCATGG + Intergenic
987181329 5:15371691-15371713 GAGAATTTCCTGAACTCACAGGG - Intergenic
987605333 5:20127231-20127253 GTAAACACCATGTCCTCACATGG - Intronic
987816328 5:22905679-22905701 AGGAATACCATGTCCTCACATGG + Intergenic
988794069 5:34636086-34636108 GTGAACTCTGTGTCCTTACATGG + Intergenic
990962076 5:61404668-61404690 GTGAAATCCCTCTCCTCTCTTGG - Intronic
991532088 5:67626809-67626831 ATGAATGCTGTGTCCTCACAAGG - Intergenic
993358526 5:86944329-86944351 GTGCCTTCTGTGTCCTCACATGG - Intergenic
993457504 5:88142939-88142961 GAGAATTCCCTTTCCTCCAAAGG + Intergenic
993458860 5:88158758-88158780 ATGAATGCTCTGTCCTTACATGG - Intergenic
994043522 5:95284374-95284396 GTGCATTCCCTGTGCCCACCGGG + Exonic
994335596 5:98561851-98561873 TTGAATGCTGTGTCCTCACATGG - Intergenic
995872175 5:116755247-116755269 GTGAATGGCATCTCCTCACAGGG - Intergenic
996586231 5:125090675-125090697 GGGAATGCTGTGTCCTCACATGG + Intergenic
997100944 5:130968842-130968864 GTAAATGCTGTGTCCTCACATGG - Intergenic
997669060 5:135655550-135655572 GTGAGTTTCCTATCCTCTCAGGG + Intergenic
998175536 5:139899653-139899675 GTCGAGTCCCTGCCCTCACAAGG - Intronic
1000375248 5:160574778-160574800 ATGAATGCTGTGTCCTCACAAGG - Intronic
1000686478 5:164255761-164255783 GTGAATCCTCTCTCCTCAGACGG - Intergenic
1000941943 5:167372405-167372427 GTGTACTCCATGTCCTCCCATGG + Intronic
1001923752 5:175621058-175621080 AGGAATGCCATGTCCTCACATGG - Intergenic
1002800185 6:514883-514905 GAGAACTCCCTGCCCTCAGAGGG - Intronic
1005849013 6:29804861-29804883 ATGAATGCAGTGTCCTCACAAGG - Intergenic
1006330479 6:33386764-33386786 ATGAATGCTGTGTCCTCACATGG - Intergenic
1008011246 6:46469884-46469906 AGGAATTCTGTGTCCTCACATGG - Intronic
1009763125 6:68034777-68034799 AGGAATCCCATGTCCTCACATGG - Intergenic
1009763134 6:68034825-68034847 GGGAATCCTGTGTCCTCACATGG - Intergenic
1010296135 6:74198660-74198682 GTGAATTCCATGTCATCCCTAGG + Intergenic
1012203857 6:96437198-96437220 GAGAATTCCCTTTCCTAGCAAGG + Intergenic
1012379718 6:98605660-98605682 GAGAATACCCTGTCCTCCGATGG + Intergenic
1013179886 6:107708701-107708723 GTGAACTCCCTGACCGCAAAGGG + Intronic
1013400354 6:109789286-109789308 GTGAATTCTCTATGATCACAAGG - Intronic
1014350698 6:120341305-120341327 ATGAATGCTATGTCCTCACATGG - Intergenic
1016428194 6:143956335-143956357 GAGAATTCCATGCCCCCACAAGG - Intronic
1018483458 6:164215316-164215338 CTGTACTCACTGTCCTCACATGG - Intergenic
1020430422 7:8112086-8112108 GTGCTTGCCCTGGCCTCACAAGG - Intergenic
1023573265 7:41594996-41595018 GTGACTTTCCTTTCTTCACATGG - Intergenic
1024123380 7:46267445-46267467 CTGCATGCCTTGTCCTCACATGG - Intergenic
1024542715 7:50492070-50492092 GTCTTCTCCCTGTCCTCACATGG - Intronic
1026277725 7:68894781-68894803 CTGTATGCCGTGTCCTCACATGG - Intergenic
1027804989 7:82807532-82807554 GTGGATTTCCTGTCCTCAAATGG - Intronic
1030277935 7:107739944-107739966 ATGAATGCTCTGTCCTCACATGG + Intergenic
1030490782 7:110231379-110231401 GTGGATACTGTGTCCTCACAGGG - Intergenic
1030543850 7:110867862-110867884 CTGAATTCATTATCCTCACATGG + Intronic
1030620605 7:111786100-111786122 GTGAATTCTCTGTCTCCAAATGG + Intronic
1031385559 7:121146232-121146254 GAAAATTCTATGTCCTCACATGG + Intronic
1033549496 7:142433867-142433889 GGGACATCCCTGTCCTCTCATGG - Intergenic
1035458676 7:159025716-159025738 GGGAAGTCCTTGTCCTCTCATGG + Intergenic
1036161793 8:6395865-6395887 GTCAAGTCTGTGTCCTCACATGG + Intergenic
1036237756 8:7055862-7055884 GTGATTTCCAGGTCCTAACAAGG + Intronic
1037505309 8:19523755-19523777 CTGAGATCCCTGTCCTCACCAGG + Intronic
1038159723 8:25025121-25025143 GTGGATGCTCTGTCCTGACATGG + Intergenic
1039136170 8:34325142-34325164 CTGAATTCAATATCCTCACAGGG - Intergenic
1039562065 8:38520465-38520487 GTTCCTTCCCTGTCCCCACAGGG - Intronic
1039600871 8:38836141-38836163 GTGTAATCCCTTTCCCCACAGGG + Exonic
1041272760 8:56124903-56124925 GTGCATTACCTGTCATCACAGGG - Intergenic
1042590441 8:70393086-70393108 CTGAGTTCCCTGTCTTCACTGGG - Intronic
1043058014 8:75464860-75464882 GTGAATTCTCTGTCCATACTTGG - Intronic
1043138559 8:76558579-76558601 GTGAATACCCTGTCCTCATGTGG - Intergenic
1043653423 8:82629863-82629885 GGGAGTTCCCTTTCCTAACAAGG - Intergenic
1050388988 9:5117065-5117087 AGGAATGCCGTGTCCTCACATGG - Intronic
1051508388 9:17849862-17849884 ATGAATGCTGTGTCCTCACATGG + Intergenic
1051886157 9:21895542-21895564 GGGAATTCCCTTTCCTAGCAAGG + Intronic
1052679636 9:31672969-31672991 GTGAATGCTGTGTCCTCTCATGG + Intergenic
1054753250 9:68930197-68930219 GGTAATTCCCTGTTCTCCCAAGG + Intronic
1055096648 9:72421267-72421289 ATGAATGCTATGTCCTCACATGG + Intergenic
1055176708 9:73327357-73327379 TTGAGTTCCTTGTCCTCAGAAGG - Intergenic
1056766019 9:89445145-89445167 GGGAGCTCCCTGTGCTCACAGGG + Intronic
1057556422 9:96091824-96091846 ATGAATGCTGTGTCCTCACATGG - Intergenic
1057745240 9:97745918-97745940 GTGAAAGCCCTAACCTCACAAGG + Intergenic
1057850776 9:98565360-98565382 GTGATTTCCCTGGGCTCATAAGG - Intronic
1057871092 9:98718376-98718398 GTGCCTTCTGTGTCCTCACATGG + Intergenic
1058849976 9:109002230-109002252 GTGTCTTCTGTGTCCTCACAAGG + Intronic
1059361929 9:113750822-113750844 ATGAACTCTGTGTCCTCACATGG - Intergenic
1059389975 9:113992903-113992925 GAGAATTCCCTGTGCTGAGAAGG + Intronic
1059626956 9:116077700-116077722 GTGAGATCCCTGTCTTCATAAGG - Intergenic
1060201303 9:121652978-121653000 GTGAGTTCCCTGTGCACAGAAGG + Intronic
1062344427 9:136108350-136108372 GTGAGGTCCCTGTCCTCACTGGG - Intergenic
1188980241 X:36720814-36720836 GCCAACTCCCTGGCCTCACAAGG - Intergenic
1189082698 X:37991551-37991573 GCCAACTCCCTGGCCTCACAAGG - Intronic
1189083149 X:37995146-37995168 GCCAACTCCCTGGCCTCACAAGG - Intronic
1190145292 X:47885647-47885669 GTGAATTCTGTGTCCTCACGTGG + Intronic
1190533728 X:51406736-51406758 GTGAATCTCCTCTCCTCACACGG - Intergenic
1192139562 X:68636147-68636169 ATGAAGTCCCTCTCCTCCCAAGG + Intergenic
1192570916 X:72203686-72203708 GTGACTTCCCTGTGGTGACATGG - Intronic
1193903417 X:87212756-87212778 TTGAATGCTGTGTCCTCACATGG + Intergenic
1194706228 X:97178882-97178904 ATGAAATCTGTGTCCTCACATGG - Intronic
1195700118 X:107698775-107698797 GTGTATTCCCTTTCCTAACATGG + Intergenic
1195854338 X:109313997-109314019 TTGAATGCTCTGTCCTCACATGG + Intergenic
1196286461 X:113886700-113886722 ATGAATGCTGTGTCCTCACATGG + Intergenic
1198617841 X:138478577-138478599 CTCAACTCCCTGTCTTCACAAGG - Intergenic
1199538599 X:148932055-148932077 GTCAATTCCCTTTCCTCTCTGGG + Intronic
1200700174 Y:6395409-6395431 GTGAGTTACCGGGCCTCACAGGG + Intergenic
1201033937 Y:9769289-9769311 GTGAGTTACCGGGCCTCACAGGG - Intergenic