ID: 979438747

View in Genome Browser
Species Human (GRCh38)
Location 4:120726051-120726073
Sequence GGCACAAGGTAGAGTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979438734_979438747 30 Left 979438734 4:120725998-120726020 CCCTTTCCCATCACACACTGCCC 0: 1
1: 0
2: 2
3: 44
4: 479
Right 979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG 0: 1
1: 0
2: 1
3: 7
4: 93
979438740_979438747 9 Left 979438740 4:120726019-120726041 CCCACTGCGAAGAGTGGCTGCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG 0: 1
1: 0
2: 1
3: 7
4: 93
979438737_979438747 23 Left 979438737 4:120726005-120726027 CCATCACACACTGCCCCACTGCG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG 0: 1
1: 0
2: 1
3: 7
4: 93
979438741_979438747 8 Left 979438741 4:120726020-120726042 CCACTGCGAAGAGTGGCTGCTCA 0: 1
1: 0
2: 1
3: 6
4: 101
Right 979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG 0: 1
1: 0
2: 1
3: 7
4: 93
979438736_979438747 24 Left 979438736 4:120726004-120726026 CCCATCACACACTGCCCCACTGC 0: 1
1: 0
2: 0
3: 40
4: 282
Right 979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG 0: 1
1: 0
2: 1
3: 7
4: 93
979438735_979438747 29 Left 979438735 4:120725999-120726021 CCTTTCCCATCACACACTGCCCC 0: 1
1: 0
2: 4
3: 52
4: 496
Right 979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG 0: 1
1: 0
2: 1
3: 7
4: 93
979438739_979438747 10 Left 979438739 4:120726018-120726040 CCCCACTGCGAAGAGTGGCTGCT 0: 1
1: 0
2: 0
3: 12
4: 104
Right 979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG 0: 1
1: 0
2: 1
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979438747 Original CRISPR GGCACAAGGTAGAGTGCTAC AGG Intronic
901890881 1:12263099-12263121 GGCATGAGGTATAGTGCTATAGG - Intronic
907225505 1:52942737-52942759 TGCCCAAGGTAGAGTGCAAATGG + Intronic
912711097 1:111950483-111950505 GGCACCAGGCACAGTGCTGCGGG - Intronic
914321859 1:146572107-146572129 TGCCCAGGGTAGAGTGCAACGGG + Intergenic
922633849 1:227143652-227143674 GGCACGAGTTACAGTGCTGCTGG + Intronic
1064757073 10:18580880-18580902 GGCACAAGGCAGAGTGATCTTGG + Intronic
1065652797 10:27911024-27911046 GGCACAAGTTACAGAGCTACTGG - Intronic
1069278952 10:66629296-66629318 GACTCAAGGCAGAGAGCTACAGG + Intronic
1070442209 10:76457644-76457666 GGCATAAGTTATAGTGCTATGGG + Intronic
1071192377 10:83116229-83116251 GGCAGAAGGCAGAGTGCTAACGG + Intergenic
1074770457 10:116730413-116730435 GGCACTTGGTAGAGTGAAACGGG - Intronic
1077845236 11:6015734-6015756 GGCCAAAGGAAAAGTGCTACAGG - Intergenic
1082241274 11:49873756-49873778 GGTAGAAGGTAGAGTAGTACAGG + Intergenic
1082875543 11:57984669-57984691 GGCACAAGGAAGACTGGTTCTGG - Intergenic
1085033546 11:73286953-73286975 GGCACAAGGTGCAGATCTACAGG + Intronic
1085740409 11:79073869-79073891 GGCATAATGTAGAAAGCTACGGG + Intronic
1088525382 11:110747453-110747475 GGCATAAGGTATAGTGCTACTGG - Intergenic
1090077433 11:123588091-123588113 GGCAGAAGGCAGAGTGGGACGGG - Intronic
1090592040 11:128282459-128282481 GGCATGAGTTAGAGTGCTATTGG + Intergenic
1092150145 12:6242286-6242308 GGCACAAGTTGGAGTGGTATGGG + Intergenic
1096713151 12:53472795-53472817 GGCAAAAGTCAGACTGCTACTGG - Intronic
1098762897 12:74447193-74447215 GGCTCGAGGTAGAGAGCTTCAGG - Intergenic
1104313424 12:127675360-127675382 GGCAAAAGGCAGAGTTCTACAGG + Intergenic
1104647436 12:130507145-130507167 GGCAAAAGGGAGAGTTCTTCCGG - Intronic
1105423592 13:20274092-20274114 GGCACAAGCTACAGTGCCAATGG - Intergenic
1107982380 13:45745869-45745891 GGCAGAAGGTAGAGAGACACAGG - Intergenic
1108525615 13:51283604-51283626 GGCAGAAGGTGGAGTGCTGGTGG - Intronic
1116551199 14:46241067-46241089 GGAACAAGGTGGAGTACTCCAGG + Intergenic
1121305370 14:92903295-92903317 AGCAAAAGGCAGAGTGCTGCAGG + Intergenic
1122447214 14:101778727-101778749 GGCTCAAGGTAGTATGATACTGG - Intronic
1122728981 14:103780951-103780973 GGCAGAGGGTAGAGTGTTACAGG + Intronic
1128148037 15:65343700-65343722 GCCACCAGGAAGAGTGCTAGTGG + Intronic
1128637043 15:69309299-69309321 GGCCCATGGAAGAGTGCTCCAGG + Intronic
1131910421 15:97193896-97193918 GGCACAGGGAAGAGGGCTCCCGG - Intergenic
1134301867 16:12999092-12999114 GGCATGAGTTATAGTGCTACTGG - Intronic
1138323903 16:56144893-56144915 GGCCAAAGGTATAGTGCAACTGG + Intergenic
1140266519 16:73426036-73426058 GGCCCAAGGGTGAGTGCTATGGG - Intergenic
1144262419 17:13535233-13535255 GGCACAAGGTATAGCACTATTGG - Intronic
1147925993 17:43946270-43946292 GGCACAAGGTGGATGGCCACTGG + Intergenic
1150229072 17:63540030-63540052 GGCACAGGGTAGGGCGCTCCAGG - Intronic
1152565714 17:81099477-81099499 GGCACAGGTGAGAGTGCTCCAGG + Intronic
1160430454 18:78808047-78808069 AGCACAAGCTACAGTGCTGCTGG + Intergenic
1161316368 19:3619397-3619419 GGCATAAGGTAGAGTGAGCCGGG + Intronic
1164907293 19:31977745-31977767 GGCACAAGGTGGAGTGGGAAGGG + Intergenic
1166558709 19:43718332-43718354 GGCACAAGTTAGAGGGCTTTGGG - Intronic
1167430848 19:49453570-49453592 GGCTCAAGGGAGCGTCCTACAGG - Intronic
1168502785 19:56907611-56907633 GGCACGAGCTATAGTGCTATTGG + Intergenic
930358647 2:50350228-50350250 GGCATGAGTTAGAGTGCTGCTGG - Intronic
930839126 2:55826019-55826041 GGCCCAAGGTAGGGGGCAACTGG - Intergenic
931093184 2:58909477-58909499 GGCACAATGTAGATTGTTATGGG + Intergenic
936038542 2:109130585-109130607 GGCAGAAGGCAGAGTGGGACTGG + Intronic
936520198 2:113207156-113207178 GGCCCAAGGCAGGCTGCTACAGG - Intronic
937126247 2:119476675-119476697 GGCAGAAGGGACAGTGCTGCGGG + Intronic
938095621 2:128460084-128460106 GGCACAAGGTAGAAAGCTCCAGG + Intergenic
940559192 2:155272865-155272887 GGCATAAGGAAGAATGCTAATGG - Intergenic
940566244 2:155364447-155364469 GGTACAAGTGAGAGTGTTACTGG + Intergenic
945161060 2:206890922-206890944 GGATTAAGGCAGAGTGCTACTGG + Intergenic
1171092665 20:22300628-22300650 AGCACAAGGAAAAGTGCTCCAGG + Intergenic
1173026930 20:39316325-39316347 GGAACAAGGTACAGTGGAACTGG + Intergenic
1179213179 21:39343625-39343647 GGTACAAATTACAGTGCTACTGG + Intronic
950372179 3:12540348-12540370 GGCAGAAGGTAGACAGCAACTGG - Exonic
951070146 3:18318561-18318583 GGCATGAGTTACAGTGCTACTGG - Intronic
951112719 3:18823821-18823843 GCCACAAGGTAGACTGTTATGGG - Intergenic
951858578 3:27225497-27225519 AGCACAAGGTACAGTGGTAATGG - Intronic
953128657 3:40116215-40116237 GGCTAAAGGTAAAGTGCTAGGGG - Intronic
953381051 3:42473245-42473267 GGCACAGGGTGGTGTGCTGCAGG - Intergenic
959500143 3:107097712-107097734 GGCAGAGGGATGAGTGCTACTGG + Intergenic
964791376 3:160455564-160455586 GTTACAAGGTAAACTGCTACAGG - Intronic
965060046 3:163773504-163773526 GGCACCAGGCAGAGTCCTAAGGG - Intergenic
967138807 3:186535408-186535430 GGCAGCAGTTAGAGTGCTGCTGG + Intergenic
971852926 4:32007214-32007236 GGCATGAGGTATAGTGCTATTGG + Intergenic
979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG + Intronic
981682244 4:147412498-147412520 GGCACAAATTATAGTGCTATTGG + Intergenic
990814224 5:59765461-59765483 GGCATAAGGTAAAGTGCTGGTGG - Intronic
993203104 5:84844729-84844751 GGCATGAGTTATAGTGCTACTGG - Intergenic
1001479642 5:172079181-172079203 GGCACAAGGTAGAATCAGACAGG - Intronic
1002797483 6:486386-486408 AGCAGAAGGTTGAGTGCTGCAGG - Exonic
1003127979 6:3371194-3371216 GGCACAAGTCAGAGTGCCAAGGG + Intronic
1009718644 6:67433840-67433862 GGCACGAGGTATAGTGCTGTTGG + Intergenic
1010156849 6:72804521-72804543 GGCACACTATAGAGTACTACCGG - Intronic
1014024859 6:116633918-116633940 GCCACCAGGTGGAGTGCTATGGG + Intergenic
1014083625 6:117316472-117316494 GGTATAAGGTAGATTCCTACAGG + Intronic
1015362441 6:132355220-132355242 GGCACAGGGTAAAATGCCACAGG - Intronic
1019823734 7:3266379-3266401 TGCAAAATTTAGAGTGCTACTGG - Intergenic
1021469581 7:20986044-20986066 GGCATGAGTTAGAGTGCTGCTGG - Intergenic
1024595242 7:50927890-50927912 GGCACAAGTTATACTGCCACTGG + Intergenic
1025014390 7:55427178-55427200 GGTACAAGGTTGAGAACTACTGG - Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1036433090 8:8707628-8707650 GGCACAAGGAAGAGGGGCACTGG - Intergenic
1042508763 8:69589716-69589738 GGCACAAGGGAGAGGGCTGATGG + Intronic
1048491818 8:134901342-134901364 GCCACTAGGCAGAGTGCTTCAGG + Intergenic
1049233860 8:141498325-141498347 CGCATTAGGTAGAGTGCTAATGG + Intergenic
1049455500 8:142684362-142684384 GACACAAGGCAGCGTGCTCCAGG + Intergenic
1052381302 9:27773775-27773797 GGTATAAGGTAGAGTGCCATTGG - Intergenic
1055250892 9:74304064-74304086 GTCACAAGGTCAAGTGCTGCGGG + Intergenic
1059668111 9:116468385-116468407 GGCCCAAGGTAGAGTAGTACTGG - Intronic
1059886727 9:118752241-118752263 GGCAGAAGTTACAGTGTTACTGG + Intergenic
1060456390 9:123802640-123802662 AGAAGAAGGAAGAGTGCTACAGG - Intronic
1062415287 9:136445909-136445931 GGCACCTGGTAGAGAGCTGCAGG - Intronic
1194966871 X:100298242-100298264 GGCACAAGGCAGAGGGCTCAAGG + Intronic
1196797442 X:119513641-119513663 GGCACAAGGCAGGGTTCCACAGG + Intergenic
1200037953 X:153345557-153345579 GGCACAAGGACAAGTGCTACTGG + Exonic