ID: 979459969

View in Genome Browser
Species Human (GRCh38)
Location 4:120970868-120970890
Sequence CAGGATTCACTCTCGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979459969_979459973 20 Left 979459969 4:120970868-120970890 CCAAACTCCGAGAGTGAATCCTG No data
Right 979459973 4:120970911-120970933 AATTACATCTCCTTTGCCACAGG No data
979459969_979459971 -5 Left 979459969 4:120970868-120970890 CCAAACTCCGAGAGTGAATCCTG No data
Right 979459971 4:120970886-120970908 TCCTGATTGATAAATCAGTGAGG No data
979459969_979459974 21 Left 979459969 4:120970868-120970890 CCAAACTCCGAGAGTGAATCCTG No data
Right 979459974 4:120970912-120970934 ATTACATCTCCTTTGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979459969 Original CRISPR CAGGATTCACTCTCGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr