ID: 979460314

View in Genome Browser
Species Human (GRCh38)
Location 4:120975142-120975164
Sequence CACAAGAGCGTAGAAGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979460314_979460317 6 Left 979460314 4:120975142-120975164 CCTTGGTCTTCTACGCTCTTGTG No data
Right 979460317 4:120975171-120975193 TACCATTTTGTTTTTATAAATGG No data
979460314_979460319 13 Left 979460314 4:120975142-120975164 CCTTGGTCTTCTACGCTCTTGTG No data
Right 979460319 4:120975178-120975200 TTGTTTTTATAAATGGCCAGTGG No data
979460314_979460320 20 Left 979460314 4:120975142-120975164 CCTTGGTCTTCTACGCTCTTGTG No data
Right 979460320 4:120975185-120975207 TATAAATGGCCAGTGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979460314 Original CRISPR CACAAGAGCGTAGAAGACCA AGG (reversed) Intergenic
No off target data available for this crispr