ID: 979466858

View in Genome Browser
Species Human (GRCh38)
Location 4:121049418-121049440
Sequence GATGATGCAAAGAGGGCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979466858_979466866 -7 Left 979466858 4:121049418-121049440 CCGCTGGCCCTCTTTGCATCATC 0: 1
1: 0
2: 0
3: 17
4: 254
Right 979466866 4:121049434-121049456 CATCATCCTGTGGGAAGTGGGGG 0: 1
1: 0
2: 2
3: 23
4: 260
979466858_979466863 -10 Left 979466858 4:121049418-121049440 CCGCTGGCCCTCTTTGCATCATC 0: 1
1: 0
2: 0
3: 17
4: 254
Right 979466863 4:121049431-121049453 TTGCATCATCCTGTGGGAAGTGG No data
979466858_979466864 -9 Left 979466858 4:121049418-121049440 CCGCTGGCCCTCTTTGCATCATC 0: 1
1: 0
2: 0
3: 17
4: 254
Right 979466864 4:121049432-121049454 TGCATCATCCTGTGGGAAGTGGG 0: 1
1: 0
2: 7
3: 28
4: 205
979466858_979466869 -1 Left 979466858 4:121049418-121049440 CCGCTGGCCCTCTTTGCATCATC 0: 1
1: 0
2: 0
3: 17
4: 254
Right 979466869 4:121049440-121049462 CCTGTGGGAAGTGGGGGTCAGGG 0: 1
1: 1
2: 13
3: 78
4: 644
979466858_979466870 8 Left 979466858 4:121049418-121049440 CCGCTGGCCCTCTTTGCATCATC 0: 1
1: 0
2: 0
3: 17
4: 254
Right 979466870 4:121049449-121049471 AGTGGGGGTCAGGGAGCCAGTGG 0: 1
1: 0
2: 4
3: 75
4: 595
979466858_979466865 -8 Left 979466858 4:121049418-121049440 CCGCTGGCCCTCTTTGCATCATC 0: 1
1: 0
2: 0
3: 17
4: 254
Right 979466865 4:121049433-121049455 GCATCATCCTGTGGGAAGTGGGG 0: 1
1: 0
2: 4
3: 41
4: 251
979466858_979466867 -2 Left 979466858 4:121049418-121049440 CCGCTGGCCCTCTTTGCATCATC 0: 1
1: 0
2: 0
3: 17
4: 254
Right 979466867 4:121049439-121049461 TCCTGTGGGAAGTGGGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979466858 Original CRISPR GATGATGCAAAGAGGGCCAG CGG (reversed) Intronic
900314138 1:2048715-2048737 GGGGATGCAAAGCGGGCCAAAGG + Intergenic
901470719 1:9454524-9454546 GATGATGCCACCAGGGACAGGGG - Intergenic
901798692 1:11694713-11694735 GGGCATGCAGAGAGGGCCAGCGG - Intronic
901961045 1:12826917-12826939 GATGATGAAAAATAGGCCAGGGG - Intronic
901975437 1:12940652-12940674 GATGATGAAAAATAGGCCAGGGG - Intronic
901983040 1:13051786-13051808 GATGATGAAAAATAGGCCAGGGG - Intronic
902009738 1:13261113-13261135 GATGATGAAAAATAGGCCAGGGG + Intronic
902154553 1:14473949-14473971 AATGATGGAAACAGGGCAAGAGG - Intergenic
903382530 1:22906961-22906983 GGGGAAGCCAAGAGGGCCAGGGG + Intronic
903607378 1:24584854-24584876 GAAGACGCAAAGAGGGCCGTGGG - Intronic
905091103 1:35432199-35432221 GATGGAGAAAAGAGGCCCAGAGG + Intergenic
905899867 1:41574420-41574442 AATGATGGGAAGGGGGCCAGGGG - Intronic
906224032 1:44106266-44106288 GAGGATGGACAGAGGGACAGAGG - Intergenic
907889148 1:58621239-58621261 GAGGATCCAAAGATGTCCAGTGG + Intergenic
907918652 1:58893500-58893522 AAGGATGCAAAGGGGGCCATGGG - Intergenic
908096443 1:60743839-60743861 GGTGATGCAAGGAGGGCATGGGG + Intergenic
908616231 1:65925909-65925931 GATAATTCAAGCAGGGCCAGGGG - Intronic
909159362 1:72126811-72126833 GATGATCCCAAAAGGCCCAGAGG + Intronic
909340489 1:74526005-74526027 GATGAGGCAAAGGGTCCCAGAGG + Intronic
913076080 1:115341541-115341563 AAGGGTGCAGAGAGGGCCAGGGG + Intergenic
913570909 1:120119182-120119204 GATGATGAATAGAGGTACAGAGG + Intergenic
914291717 1:146280158-146280180 GATGATGAATAGAGGTACAGAGG + Intergenic
914552761 1:148730941-148730963 GATGATGAATAGAGGTACAGAGG + Intergenic
915165041 1:153943807-153943829 GATGAGGAAAACAGGCCCAGAGG + Intronic
916589523 1:166176827-166176849 GCTGAGGGAAAGAGGTCCAGAGG - Intergenic
920109276 1:203575666-203575688 GATGAGGCAGACAGGGACAGTGG - Intergenic
921498826 1:215875052-215875074 GATGTTGCCAAGGTGGCCAGTGG + Intronic
922625703 1:227039563-227039585 GATGAAGGAGAGAGGGTCAGGGG - Intronic
922777047 1:228219668-228219690 GGTGACGCAGAGAGGGGCAGAGG - Intronic
1063055313 10:2497734-2497756 GATGATGGAAACAGGGAAAGGGG + Intergenic
1064434761 10:15301662-15301684 GGCAATGCAAAGAGGGCCAGAGG - Intronic
1070723235 10:78771058-78771080 GGTGATGCCCAGAGAGCCAGAGG - Intergenic
1073486711 10:103823832-103823854 GATGAGGGAAAGAAGGGCAGCGG + Intronic
1075349798 10:121713568-121713590 GATGATGGAAAGAGGACAGGAGG - Intergenic
1075650073 10:124121994-124122016 GGTGAGGCAAAGAGAGACAGAGG - Intergenic
1076022695 10:127087409-127087431 GCTGATGCTAACAGGGGCAGGGG + Intronic
1076356723 10:129858594-129858616 GCTGAGACAAAAAGGGCCAGTGG + Intronic
1078326863 11:10388222-10388244 GGAGATGCAAAGAGAGCCAGTGG - Intronic
1079988859 11:27226164-27226186 GATCATCCAAAGAGGGGCATTGG - Intergenic
1081312459 11:41590547-41590569 CATGATGCACAGAGTGGCAGTGG - Intergenic
1081329803 11:41788830-41788852 GAGGGTGCAAAGAGTGTCAGTGG - Intergenic
1081607806 11:44538103-44538125 GAAGATGCCAGGAGAGCCAGTGG - Intergenic
1081639435 11:44742750-44742772 GCTAATGCAAAGAGAGCAAGAGG + Intronic
1082167170 11:48963223-48963245 GAAGATGCAAAGAGTGCCTTGGG + Intergenic
1083404606 11:62447952-62447974 GAGGATGCTGAGAGGGCCTGTGG + Intronic
1083696142 11:64443974-64443996 GTTGATGCAGAAAGAGCCAGTGG + Intergenic
1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG + Intronic
1084022451 11:66425830-66425852 AATGATGAAATGATGGCCAGAGG - Intronic
1084330462 11:68426976-68426998 GCTGAGGCAGAGAGGGCCACGGG - Intronic
1098020839 12:66154866-66154888 GATTTTGGAAAGAGTGCCAGAGG - Intronic
1098160211 12:67642402-67642424 GGGCATGCAAAGAGGGCAAGTGG - Intergenic
1098537188 12:71606249-71606271 GATGGCCCAAAGTGGGCCAGGGG - Intergenic
1105235347 13:18546315-18546337 GAGGATGGAAAGAGGGTGAGAGG + Intergenic
1105236908 13:18565181-18565203 GAGGATGCAGAAATGGCCAGAGG - Intergenic
1105603471 13:21908099-21908121 GAGGATGCAAACAGGGACACTGG - Intergenic
1105896761 13:24723238-24723260 GATGAAGCAAAGAGGGGCCATGG - Intergenic
1106033325 13:26021978-26022000 CAGGATGCAGAGAGGGCCTGAGG + Exonic
1106371613 13:29139886-29139908 GCTGATGGAGAGAGCGCCAGAGG - Intronic
1106504068 13:30356058-30356080 GAAGAGGTAAAGAGGGCCACTGG - Intergenic
1106763661 13:32892531-32892553 GAGGATGCTGAGAAGGCCAGGGG + Intergenic
1108264463 13:48691331-48691353 GATGAAGGAAAGAGGGTCACTGG + Intronic
1108905843 13:55471692-55471714 GTTCATGCAAAGAGGACCTGTGG - Intergenic
1110309175 13:74027318-74027340 GATGATGAAAAAAGGGAGAGGGG - Intronic
1111048107 13:82842695-82842717 GGTGATGCAAAGAGAGACAGAGG + Intergenic
1115806752 14:37060683-37060705 GAGGTTGCAAAGATGGGCAGTGG - Intronic
1116368430 14:44099936-44099958 GATGATGTAAAGAGACACAGGGG - Intergenic
1117220879 14:53604266-53604288 CAAGATGGAAAGAGGGACAGTGG - Intergenic
1117420832 14:55543400-55543422 GATGCTGAAAAGAAGGCCAAGGG + Intergenic
1119569336 14:75656363-75656385 GTTGAGGCAAAGAGGTCCAGAGG - Intronic
1120014752 14:79459016-79459038 GATGATGGAAAGAAGGACAATGG - Intronic
1120302732 14:82728872-82728894 CATCCTGCAAAAAGGGCCAGAGG + Intergenic
1121896394 14:97652047-97652069 GATGATACACAGAGAGACAGTGG + Intergenic
1122166772 14:99831326-99831348 TATAATGAAAAGAGAGCCAGGGG + Intronic
1122523119 14:102360770-102360792 TCTGATGCACAGAGGGCAAGTGG - Intronic
1126473958 15:49046592-49046614 GAGGAGGCAGAGAGGGGCAGTGG + Intergenic
1128808713 15:70554550-70554572 TATGATGCCAACAGGACCAGTGG + Intergenic
1129039835 15:72676328-72676350 GATGATTCAAAGGGGGCCTCCGG + Exonic
1129231529 15:74199647-74199669 GGTGATACAGAAAGGGCCAGAGG - Intronic
1130715209 15:86327063-86327085 GATAGAGCAAAGAGGGACAGAGG + Intronic
1130916268 15:88307480-88307502 GAGGGTGGAAAGAGGGGCAGAGG - Intergenic
1132094943 15:98976644-98976666 GAAGAGGCAAGGAGGGGCAGTGG + Intronic
1132947566 16:2540294-2540316 TCTGATGCTAAGTGGGCCAGAGG + Intronic
1133639786 16:7705568-7705590 GAAGATTGAAAGAGGGACAGAGG + Intronic
1134045526 16:11098335-11098357 GAGGATGCAGAAAGGGACAGGGG + Intronic
1134839391 16:17389602-17389624 GATGATGTAAAAATGGCCTGGGG - Intronic
1135722744 16:24831070-24831092 GAAGATGCAATGATGGCAAGGGG - Intergenic
1135743697 16:24998141-24998163 GATGATGCAAACTGGGCCCCGGG + Intronic
1135971705 16:27076752-27076774 GATGATCAAATGAGAGCCAGTGG + Intergenic
1141404044 16:83775848-83775870 GCTGATGGAAAGAGGAACAGAGG + Intronic
1143419499 17:6777758-6777780 GATTATACAAAGAGGGGCACTGG + Intronic
1144490759 17:15706860-15706882 CATGTGGCAAAGATGGCCAGTGG + Intronic
1146792000 17:35756288-35756310 GATGATCCAAAGTAGGCAAGTGG + Intronic
1147363587 17:39946142-39946164 GAGGGTGCAAAGAGGGGCAAGGG + Intergenic
1147774847 17:42893397-42893419 GTTGAAGCAAGGAGGGACAGCGG + Intergenic
1148612138 17:48971612-48971634 GAATATGCGAGGAGGGCCAGGGG + Intergenic
1148891923 17:50814161-50814183 GATGAAGCTAAGAGGCCCTGGGG + Intergenic
1150125267 17:62630920-62630942 GATGACTCACAGAGAGCCAGAGG - Intronic
1150448654 17:65247136-65247158 GATGATGCTAACAGGGTCAAGGG + Intergenic
1150578097 17:66447730-66447752 GATGGAGCACAAAGGGCCAGGGG - Intronic
1151271393 17:72999049-72999071 GATGATTCCAAGAGGGCAACAGG + Intronic
1151738184 17:75959545-75959567 GAAGATACAAAGAGGAACAGCGG + Intronic
1152072851 17:78142592-78142614 GATGAGGCCAAGAGGGAAAGAGG + Exonic
1152331484 17:79675710-79675732 GAAGATCCACAGAGGGCCAACGG + Intergenic
1154512634 18:15124736-15124758 GAGGATGCAGAAATGGCCAGAGG + Intergenic
1154514191 18:15143691-15143713 GAGGATGGAAAGAGGGTGAGAGG - Intergenic
1155121891 18:22829368-22829390 GATGATGCAAAAAGAGAAAGTGG - Intronic
1155344791 18:24847616-24847638 GATGATGGAAAAAGGATCAGGGG + Intergenic
1156462108 18:37326839-37326861 GTTGATGCAAAAAGTGGCAGAGG - Intronic
1157699853 18:49755262-49755284 GATGATGAAACTAAGGCCAGTGG + Intergenic
1158678476 18:59544663-59544685 GATGAGGGAAAGAGGGAAAGAGG + Intronic
1158696586 18:59709191-59709213 GATGTTGCAAAGAAAGGCAGAGG + Intergenic
1159184372 18:64949748-64949770 GTTGATGCGAGGAGGGTCAGTGG + Intergenic
1161354166 19:3810067-3810089 GATGAGGCACACAGGCCCAGTGG + Intronic
1164441382 19:28282887-28282909 GATGGTGCAAAAGGGGACAGTGG - Intergenic
1164708369 19:30336942-30336964 GATGATACAAAAATTGCCAGTGG - Intronic
1164989369 19:32673522-32673544 GAAGCTGCAAAGGTGGCCAGAGG - Intronic
1166105801 19:40597486-40597508 GGAGATGCAAAGAGGGCCCTTGG + Intronic
1167667596 19:50831772-50831794 GATGATGGAGAGAGATCCAGGGG - Intronic
925267313 2:2574993-2575015 AAACATGCAATGAGGGCCAGCGG - Intergenic
925493750 2:4423690-4423712 GAAGCTGCAAGGAGTGCCAGGGG - Intergenic
925719682 2:6814764-6814786 CAAGATGAAAAGAGGTCCAGGGG + Intergenic
927209813 2:20632196-20632218 AAAGATGCAAAGAGAGGCAGGGG - Intronic
927727382 2:25436901-25436923 GATGATGAAAAGAAGCCCTGTGG + Intronic
928925482 2:36574839-36574861 GATGCTGCAAAAAAGGACAGAGG + Intronic
929762205 2:44815664-44815686 GATGATGTGAGGATGGCCAGAGG + Intergenic
931376100 2:61709720-61709742 TAGGTTGCAAAGAGGGCCAGTGG + Intergenic
931873270 2:66484273-66484295 GATGAGGCAGAGAGGGTGAGCGG - Intronic
932326108 2:70862917-70862939 AAGCAAGCAAAGAGGGCCAGTGG - Intergenic
937342528 2:121100398-121100420 GATGATGCTGAGAGGGACAGAGG - Intergenic
937823919 2:126344016-126344038 GAGGAGGCACTGAGGGCCAGTGG - Intergenic
938257604 2:129871737-129871759 TATGATGCTAAGACTGCCAGCGG - Intergenic
938514432 2:131988302-131988324 GAGGATGGAAAGAGGGTGAGAGG - Intergenic
939632111 2:144537604-144537626 CATGATAGAAAGAGGGGCAGTGG - Intergenic
939914357 2:148021122-148021144 GATGATGAAGAGAGAGGCAGTGG + Intronic
940240125 2:151553617-151553639 CATTATGCAAAGAGGCTCAGGGG + Intronic
943366974 2:186975603-186975625 GCTGTTGCAAGGAGGGCCAGGGG + Intergenic
946073647 2:217055488-217055510 GATGATGCAGAGAGGCTAAGGGG + Intergenic
946096645 2:217280391-217280413 GATAATGCCAAAAGGGCCATTGG + Intergenic
946503759 2:220277233-220277255 GATGTTGGAAAGAGGGGAAGAGG - Intergenic
947337681 2:229103937-229103959 GATGATCCAAACATGGGCAGTGG - Intronic
947611253 2:231526360-231526382 CCTGGTGCACAGAGGGCCAGCGG + Intronic
948571848 2:238922609-238922631 GCTGCTGCAAAGAGGCCCCGAGG - Intergenic
948685847 2:239669435-239669457 GGTGTTGCAAAGTGGGCGAGAGG - Intergenic
948708636 2:239811347-239811369 GAGGTTGTAAATAGGGCCAGAGG + Intergenic
948778248 2:240301150-240301172 GATGATGCAGAGATGGGAAGAGG - Intergenic
1169333093 20:4731756-4731778 GATGAGGCAAAGAAGGACATTGG - Exonic
1171723026 20:28584390-28584412 GAGGATGTAAGGAGGGTCAGAGG + Intergenic
1171755058 20:29099062-29099084 GAGGATGTAAGGAGGGTCAGAGG - Intergenic
1171787629 20:29483830-29483852 GAGGATGTAAGGAGGGTCAGAGG + Intergenic
1171860324 20:30395551-30395573 GAGGATGTAAGGAGGGTCAGAGG - Intronic
1172880634 20:38197666-38197688 GATGATGCCAAGATGGGGAGGGG - Intergenic
1173603134 20:44310392-44310414 GATGATCCAAGGAGATCCAGGGG + Intronic
1173744638 20:45426885-45426907 GTTGATGCCAAGTGTGCCAGAGG - Intergenic
1174286670 20:49478984-49479006 GATGACTCAAAGGAGGCCAGAGG + Intronic
1174568185 20:51482050-51482072 GAAGAAACAAACAGGGCCAGTGG - Intronic
1175645094 20:60664257-60664279 GACGTGGCAAGGAGGGCCAGTGG + Intergenic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1176779343 21:13174599-13174621 GAGGATGGAAAGAGGGTGAGAGG + Intergenic
1176780895 21:13193466-13193488 GAGGATGCAGAAATGGCCAGAGG - Intergenic
1177976987 21:27863633-27863655 GAGGATGGAAAGAGGGTGAGAGG + Intergenic
1177978574 21:27882579-27882601 GAGGATGCAGAAATGGCCAGAGG - Intergenic
1178580645 21:33835237-33835259 GCTCAAGCAAAGAGGCCCAGTGG - Intronic
1179544098 21:42102952-42102974 GGTGATGCAGAGGGGACCAGGGG + Exonic
1180080344 21:45483747-45483769 GATGAGGGAAGGAAGGCCAGTGG + Intronic
1180296581 22:10943060-10943082 GAGGATGTAAGGAGGGTCAGAGG + Intergenic
1180412090 22:12622935-12622957 GAGGATGTAAGGAGGGTCAGAGG - Intergenic
1181614418 22:24043026-24043048 GGTTATCCAAACAGGGCCAGTGG - Exonic
1182860254 22:33553716-33553738 GACGTTGCAAAGATGGCAAGAGG + Intronic
1183073140 22:35410293-35410315 GAAGAGGCAAAAAGGGCGAGTGG + Intronic
1184177608 22:42797885-42797907 GAGGATGCTCAGTGGGCCAGAGG + Intronic
1184449225 22:44573113-44573135 GATGAATCAGAGAGGCCCAGAGG - Intergenic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
949732249 3:7126994-7127016 AATTATGCAAAGGTGGCCAGTGG + Intronic
950185920 3:10945438-10945460 GATGATGGAGAGAGGGGCAGAGG + Intergenic
950359093 3:12437703-12437725 CATGATGCAGAGACAGCCAGGGG - Intergenic
950903964 3:16520775-16520797 GAGGATGCAAAGATGTCCTGTGG + Intergenic
950981367 3:17309765-17309787 GATCTTGCAAAGAGTACCAGGGG + Intronic
952158679 3:30671440-30671462 GATGACGAACAGATGGCCAGAGG + Intronic
952541562 3:34372878-34372900 GAAGATGGAAAGGGGGCTAGAGG + Intergenic
953497577 3:43401787-43401809 GATGCTCCAAAGAATGCCAGGGG - Intronic
954010043 3:47628356-47628378 GATGATGCAAAGAAGCTGAGAGG - Intronic
954287757 3:49630848-49630870 GGTGATGGAAAGAGAGCCAGAGG + Intronic
956189101 3:66591543-66591565 GGTGGGGCAAAGAGGGGCAGAGG + Intergenic
962433124 3:135338561-135338583 GATGATGTAAAGTGGGGCAAGGG + Intergenic
962458928 3:135591228-135591250 GTTGAAGCAGAGAGGGACAGAGG - Intergenic
964071036 3:152633762-152633784 GATGATGCAGAGATGGTCAATGG - Intergenic
965237348 3:166142393-166142415 GATGATGCAAACAAGGCTAGGGG - Intergenic
966948713 3:184796605-184796627 CAGGATGAAAAGAGGGCCGGCGG + Intergenic
968189426 3:196656871-196656893 GATAATGTGATGAGGGCCAGTGG - Intronic
968357323 3:198119639-198119661 CATAATGCAGAAAGGGCCAGGGG - Intergenic
968912686 4:3484058-3484080 GAAGGTGCACAGGGGGCCAGGGG + Intronic
974097736 4:57383406-57383428 GATGATACAGAGATGTCCAGGGG + Intergenic
975343873 4:73272241-73272263 CATGATATAAAGAGGGCCAAAGG - Intergenic
977867541 4:102047711-102047733 GAAAATGCAAAGAAGGCCACAGG + Intronic
979466858 4:121049418-121049440 GATGATGCAAAGAGGGCCAGCGG - Intronic
980211256 4:129791220-129791242 GATGAAGAAAAGAGGGCTATGGG + Intergenic
985438490 4:189959373-189959395 GAGGATGTAAGGAGGGTCAGAGG - Intronic
985891698 5:2720711-2720733 GAAGATGCAGAGAGGGCGAGAGG - Intergenic
986311838 5:6556931-6556953 GATACTGCAATGGGGGCCAGGGG + Intergenic
986735283 5:10663425-10663447 GCTGATGGAAAGTGAGCCAGTGG - Intergenic
990884791 5:60579350-60579372 GCTGCTGCACAGTGGGCCAGCGG + Intergenic
998131576 5:139653981-139654003 GCTGACCCAAAAAGGGCCAGTGG - Intronic
998456759 5:142279833-142279855 CCTGATTCAAAGAGGGGCAGGGG + Intergenic
998857702 5:146409665-146409687 GAAGATGCAGAGAGGACAAGTGG - Intergenic
1003377155 6:5590203-5590225 AATGATGCATAGATGACCAGTGG + Intronic
1006031187 6:31177775-31177797 GATGCTGCAAGGAGGGCAGGTGG - Intronic
1007004033 6:38342967-38342989 GATGGTCCAAGGAGGGTCAGAGG + Intronic
1011609882 6:89140544-89140566 GATGTTGTATAGAGGACCAGGGG + Intergenic
1012739204 6:102992935-102992957 GCTGGAGCAAAGAGAGCCAGAGG + Intergenic
1016661649 6:146587993-146588015 GATGATGGAAGGAGGTACAGAGG - Intergenic
1016906400 6:149154778-149154800 GATGAAGCAGAGAGAGCCAGAGG - Intergenic
1017120885 6:151022952-151022974 GATCATGGAAAGGGGGCCAGGGG - Intronic
1018558533 6:165075298-165075320 TATGGTGGAAAGAGGGCAAGAGG + Intergenic
1018954593 6:168400318-168400340 GAGGAAGCAATGAGGGGCAGGGG - Intergenic
1019005847 6:168795677-168795699 GATGATGAAAAGAGGAGCAATGG - Intergenic
1019578942 7:1750668-1750690 ACTGAGGCAGAGAGGGCCAGTGG - Intergenic
1019885488 7:3900746-3900768 GAGCATGCAAAGAGGGAAAGAGG - Intronic
1021243692 7:18236160-18236182 GATCATGCAATGAGAGCCACTGG - Intronic
1022943830 7:35262636-35262658 AATGTTTCAAAGAGGTCCAGTGG + Intergenic
1023105913 7:36763172-36763194 GAGAATCCAAAGAGGGCAAGAGG + Intergenic
1023393311 7:39730876-39730898 GATGAGGAAAAGAGGCCCAGAGG + Intergenic
1024410653 7:49037527-49037549 GATGCAACCAAGAGGGCCAGTGG + Intergenic
1024899347 7:54300093-54300115 GATTATGCAAGGAGGGCAAGGGG - Intergenic
1026251616 7:68676091-68676113 GATGAAGCCAAGAGGACAAGTGG - Intergenic
1029374429 7:100169413-100169435 GAAGATGCTCAGAGGCCCAGAGG + Intergenic
1029794135 7:102875906-102875928 GATGATGCAAAGAAAGGTAGAGG + Intronic
1030403190 7:109078550-109078572 GCAGCTGCAAAGAGGGGCAGGGG + Intergenic
1031037461 7:116803510-116803532 GTTGATTCAAAGTGGGGCAGGGG + Intergenic
1032414335 7:131724911-131724933 CCTGTTGCAAGGAGGGCCAGAGG - Intergenic
1032456178 7:132075153-132075175 GAAGATGCAAAGAAGGACTGTGG + Intergenic
1033149288 7:138899292-138899314 GTTGATGGGAAGAGGGACAGTGG + Intronic
1035097367 7:156366265-156366287 GATGAGGCATTGAGGCCCAGAGG - Intergenic
1036402705 8:8424546-8424568 GATTATGCAAAGAGGTACCGGGG - Intergenic
1036583911 8:10105328-10105350 GATGAGGCAGAGAGGGCTAATGG + Intronic
1036700190 8:11008263-11008285 CATGATGCAAAAAGGCCCAAGGG + Intronic
1036939913 8:13041415-13041437 GCTGATGCAAGGATGGCGAGTGG - Intergenic
1038700147 8:29842344-29842366 GATGCTGCAAAGAAGGGCAAAGG - Intergenic
1040578450 8:48675019-48675041 GTTGGTGCAAACAGGACCAGAGG - Intergenic
1041117167 8:54551107-54551129 GATGATGAAAATAAGGCAAGTGG - Intergenic
1041622179 8:59984365-59984387 AATGATGCTAAAAGGGCCATGGG + Intergenic
1045242107 8:100411618-100411640 GAGGAGGAAAAGAGGGACAGAGG + Intergenic
1045721087 8:105111680-105111702 GGTGATTCAAAGAGGGCAGGTGG + Intronic
1050019706 9:1270101-1270123 GATGAAGCAGAGAGGGAGAGAGG - Intergenic
1051653808 9:19357966-19357988 GATGAAATAAAGAGAGCCAGTGG + Exonic
1052409745 9:28107687-28107709 GACAAAGCAAAAAGGGCCAGTGG + Intronic
1053747509 9:41214709-41214731 GAGGATGTAAGGAGGGTCAGAGG - Intergenic
1054479776 9:65650659-65650681 GAGGATGTAAGGAGGGTCAGAGG + Intergenic
1055007940 9:71529774-71529796 GATGATGCAAAGCTGACCACTGG - Intergenic
1056119497 9:83473215-83473237 GAAGAGGCAAGGTGGGCCAGGGG - Intronic
1056264303 9:84880976-84880998 GATAATGCATAGAGGTTCAGCGG - Intronic
1056468531 9:86882788-86882810 GATGAAGCAAAGAGCTCAAGTGG - Intergenic
1056793039 9:89638490-89638512 GATGCTGCAAGGAGGGGCAGGGG - Intergenic
1057283085 9:93726753-93726775 TATGATTCACAGAGGGCCTGAGG - Intergenic
1058620237 9:106875167-106875189 GATCATGGAAAGGGGGCAAGAGG - Intronic
1059932115 9:119271281-119271303 AATGATGGAAAGAGGGACACTGG + Intronic
1062295794 9:135825818-135825840 GAAGAGGCAAAGACGGGCAGAGG + Intronic
1062400764 9:136371685-136371707 GGTGCTGCCAAGAGGGGCAGCGG - Intronic
1203448231 Un_GL000219v1:81310-81332 GAGGATGTAAGGAGGGTCAGAGG + Intergenic
1186362198 X:8853791-8853813 GATGGAGGAAATAGGGCCAGGGG + Intergenic
1187944259 X:24411260-24411282 GAAGATACAAACAGGGCCCGTGG + Intergenic
1188263635 X:28043604-28043626 GATGAGGCACAGGTGGCCAGTGG - Intergenic
1189243186 X:39541383-39541405 GCTGATGCAAAAGGGGGCAGAGG + Intergenic
1190740416 X:53284787-53284809 GAGGCTGCAAGGTGGGCCAGTGG + Intronic
1190898195 X:54641539-54641561 GGGGATGTAAAGATGGCCAGTGG - Intergenic
1192072741 X:67958386-67958408 AATTATGCAAAGAGGGCCAAAGG - Intergenic
1193125642 X:77867455-77867477 GGCAATCCAAAGAGGGCCAGTGG - Intronic
1194962314 X:100249902-100249924 GTTGATACAAACAGGGCCACAGG + Intergenic
1196825266 X:119735615-119735637 GATGCTAGAAAGAGGGCCACAGG + Intergenic
1197748341 X:129947954-129947976 GGAGAGGCAAAGATGGCCAGGGG + Intergenic
1197849166 X:130838608-130838630 AATGAAACAAAGATGGCCAGGGG - Intronic
1198767404 X:140093187-140093209 GATGCTGCAAAGAGGTGCTGTGG + Intergenic
1201581484 Y:15515221-15515243 GAGGATGCAAAGAAGGGAAGGGG - Intergenic