ID: 979467292

View in Genome Browser
Species Human (GRCh38)
Location 4:121055269-121055291
Sequence AAGGCTACTGCAGTTGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 2, 2: 3, 3: 34, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979467292 Original CRISPR AAGGCTACTGCAGTTGTCCA TGG Intronic
901099458 1:6708153-6708175 GAGGCTATTGCAGTGTTCCAAGG + Intergenic
902184685 1:14716513-14716535 GAGGTTACTGCAATGGTCCAAGG - Intronic
903094356 1:20955617-20955639 AAGGTTACTTCAGTAGTCCAAGG + Intronic
903857291 1:26344751-26344773 AAGTCAACTGAGGTTGTCCAGGG - Exonic
904769245 1:32871630-32871652 CAGGCTACTTGACTTGTCCAGGG + Intronic
904810235 1:33158795-33158817 AAAGCTACATCAGTTGGCCAAGG - Intronic
905249228 1:36637401-36637423 AAGGATACAGCAGTGATCCAAGG + Intergenic
905353304 1:37362687-37362709 AAGGATTCTGGAGCTGTCCAAGG + Intergenic
906514092 1:46428819-46428841 GAAGCTACTGTTGTTGTCCATGG + Intergenic
907754504 1:57298017-57298039 AAGGAACCTGCAGTGGTCCAGGG - Intronic
907770983 1:57463182-57463204 AAAGCCACTGAAGCTGTCCAGGG - Intronic
908819062 1:68064421-68064443 AAGGTGATTGCTGTTGTCCATGG + Intergenic
910928580 1:92420748-92420770 AAGGCTACTGCAGATGATGAAGG + Intergenic
911380766 1:97111157-97111179 GAGGCTATTGCAGTAGCCCAAGG - Intronic
911867292 1:103045405-103045427 AAGGCTCTTGCAATTATCCAAGG + Intronic
916835028 1:168535095-168535117 AAGGTTAAAGCATTTGTCCAGGG - Intergenic
917360836 1:174174269-174174291 AAAGCTAATTTAGTTGTCCAAGG - Intronic
917545295 1:175960765-175960787 AAAGCTACTCCTGATGTCCAAGG + Intronic
918322805 1:183381015-183381037 AAGTCTTCTTCAGTGGTCCAGGG + Intronic
919066740 1:192701115-192701137 AAGGCTAATGCTGTTTTCTATGG + Intergenic
919110069 1:193207438-193207460 GAGGGTACTGCAGGAGTCCAGGG + Intronic
919538133 1:198813946-198813968 GAGGGTACTGCAGGTGACCAGGG + Intergenic
919902718 1:202056097-202056119 GAGGCTACTGCAGGCCTCCAGGG + Intergenic
920581021 1:207107764-207107786 AAGGCTTTTGCAGTGGTCTAGGG + Intronic
920909005 1:210196518-210196540 AAGGGTACTGCAGGAGACCAGGG + Intergenic
921588164 1:216973064-216973086 GAGGCTGCTGCAGTTCTCCAGGG - Intronic
923361160 1:233212532-233212554 ATGGCAGATGCAGTTGTCCAGGG + Intronic
923398324 1:233589834-233589856 AAGGCTGCTGCAGTACTCCATGG - Intergenic
923607364 1:235456672-235456694 AAGGTTACTGCAGCGATCCAGGG + Intronic
923939617 1:238807015-238807037 AAGGCTATTGCTGGTCTCCATGG - Intergenic
924075710 1:240333882-240333904 AAGGCTTCTGCTATTGTCCTAGG - Exonic
924322629 1:242865109-242865131 GAAGCTGCTACAGTTGTCCAAGG - Intergenic
1063329113 10:5138192-5138214 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1064803285 10:19100431-19100453 AAAGCTGCTTCAGTAGTCCAGGG + Intronic
1065261848 10:23931874-23931896 AAGGATAATGCAGTCCTCCAGGG + Intronic
1065542012 10:26779977-26779999 AGGGCTACTGGAGTTTTCTAAGG - Intronic
1066681184 10:37938021-37938043 AAGACAACTGAAGCTGTCCAGGG + Intergenic
1067759150 10:49030137-49030159 ATGGCTACTGAAGACGTCCAGGG + Intronic
1068136175 10:52952910-52952932 AAGACAACTGAAGTGGTCCAGGG - Intergenic
1070830696 10:79416414-79416436 AAGGCTGCTGGGGGTGTCCAGGG + Intronic
1071948888 10:90680226-90680248 AAGACTATTTCAGTTGTCCCAGG + Intergenic
1072715271 10:97747979-97748001 CAGGCTACTGAAATTCTCCAGGG - Intronic
1074169909 10:110921499-110921521 AAGGGTACTGCATTTTCCCAAGG + Intronic
1074209560 10:111317730-111317752 AAGGCTAAGGAATTTGTCCAAGG - Intergenic
1074470298 10:113720915-113720937 AAGGATACTGCAGTTTTCTTAGG + Intronic
1074918531 10:117982990-117983012 ATGGGTATTGCTGTTGTCCAGGG - Intergenic
1075049750 10:119174523-119174545 AAGGGTACAGCCGTTGTCAATGG - Exonic
1076196103 10:128519484-128519506 ACGGCTACTGCATGTGTCGATGG - Intergenic
1076538380 10:131197579-131197601 AAGGCAACTGCAGTCATCCCTGG + Intronic
1077104771 11:837398-837420 GAGGCTCCTGCAGAGGTCCAGGG - Intronic
1077463159 11:2721011-2721033 CTGGCTGCTGCAGGTGTCCAGGG - Intronic
1078132797 11:8626637-8626659 GAGGCTACTACTGTTGTCTAGGG - Intronic
1078142430 11:8702059-8702081 AAGGCAACTGCAGTGGCCCAGGG - Intronic
1078945881 11:16068177-16068199 AAGCCTAGTTCAGTTCTCCAGGG + Intronic
1080008100 11:27430676-27430698 AAGGCTACTGTCGTGGTCCCGGG - Intronic
1081344358 11:41964741-41964763 AAGGCTACTGTAATTCTCTAAGG - Intergenic
1084113270 11:67027037-67027059 AAGGCCACTGCAGCTAGCCAGGG + Intronic
1085689116 11:78651299-78651321 AAAGCTGCTGCAGCTGTGCAAGG - Intergenic
1085794874 11:79530028-79530050 GAGGCTGATGCAGTGGTCCAGGG - Intergenic
1086049885 11:82577482-82577504 AAGGCCACTGCACTGTTCCATGG - Intergenic
1089087646 11:115836814-115836836 GAGGCTACTGCAGTTGTCCATGG + Intergenic
1089394810 11:118129672-118129694 AAAGCTACTGCAATAATCCAGGG + Intergenic
1089771508 11:120806498-120806520 AGGGTTAGGGCAGTTGTCCAGGG - Intronic
1089873913 11:121701706-121701728 GAGGCTGCTGCAATTGTCCAGGG + Intergenic
1090466842 11:126942600-126942622 AAAGCAACTGCATTTGTCCTAGG + Intronic
1093867904 12:24250477-24250499 AATGACACTGCAGTTGTCCTTGG + Intergenic
1094244941 12:28278818-28278840 AAGGCTAATTAAGTTGACCAAGG - Intronic
1095659162 12:44709117-44709139 ATGGACACTGCAGGTGTCCAAGG - Intronic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1098667884 12:73186912-73186934 AAGGCTGCTGCAGTTTTCTGGGG + Intergenic
1101910772 12:108858695-108858717 GAGGCTGCTGCTGTTGTCCCGGG + Intergenic
1101968120 12:109294582-109294604 ACAGCCACTGCAGGTGTCCAGGG - Intronic
1102288239 12:111677074-111677096 AAGGATAGTGCAGATGTACAAGG + Intronic
1104932330 12:132346224-132346246 AAGGAAACTGCAGCCGTCCATGG - Intergenic
1106122281 13:26870583-26870605 GAGGCTACTGCACTGGTCCAGGG - Intergenic
1106526304 13:30543917-30543939 GATGCTATTGCTGTTGTCCATGG - Intronic
1107207178 13:37806592-37806614 AATGTCATTGCAGTTGTCCATGG - Intronic
1109514723 13:63427341-63427363 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1109613772 13:64802875-64802897 GAGGCTTGTGCAGTTGTACAGGG - Intergenic
1109918109 13:69018386-69018408 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1111751809 13:92342278-92342300 GAGGCTACTGCAATATTCCAGGG - Intronic
1116205821 14:41864583-41864605 AAGGTTACTGCAGATGTAAATGG - Intronic
1117737601 14:58783327-58783349 GAGGCCAGTGCAGTTGTCAAGGG + Intergenic
1117938241 14:60932296-60932318 AAGGCTGCTGTAGTTTTACAAGG - Intronic
1118470271 14:66068746-66068768 GAAGCTGTTGCAGTTGTCCAGGG + Intergenic
1119333305 14:73811678-73811700 GAGGCTTTTTCAGTTGTCCAGGG - Intergenic
1119939541 14:78625734-78625756 AAGACTACTTCAGCTTTCCAGGG - Intronic
1122234881 14:100325863-100325885 AAGGCCCCTGCACCTGTCCACGG + Intronic
1122529828 14:102417908-102417930 GAGGCTGCTGCAGGAGTCCAGGG + Intronic
1123142162 14:106090814-106090836 ATGGCTACTGGAATTGACCAAGG - Intergenic
1124408809 15:29418226-29418248 AATGCTAATGCATTTGTACATGG - Intronic
1124437946 15:29666442-29666464 AAGGCCACTGTAACTGTCCATGG - Intergenic
1125005880 15:34817341-34817363 AAGGTTACTGTAGTTATTCATGG - Intergenic
1126999498 15:54485493-54485515 AAGGCTACTGCAGTAGAACAAGG - Intronic
1129386012 15:75196412-75196434 CAGGCTACTGCTGGTGTCCTGGG + Intronic
1130559168 15:84945151-84945173 AAACCGACAGCAGTTGTCCAGGG - Exonic
1130944750 15:88542395-88542417 AAGACAACTGAAGTTGTCCAGGG + Intronic
1133578320 16:7116604-7116626 AAGCCCACAGCAGCTGTCCAGGG + Intronic
1135128318 16:19830191-19830213 AATGAAACTGCAGTTGTGCATGG - Intronic
1137795391 16:51213136-51213158 GAGGCTAATGGACTTGTCCAGGG + Intergenic
1138960025 16:62018108-62018130 AAGGTTACTGAAGTTTTTCAAGG - Intronic
1140645693 16:77027727-77027749 AAATCGCCTGCAGTTGTCCATGG + Intergenic
1141678254 16:85529098-85529120 GCGGCGCCTGCAGTTGTCCAGGG + Intergenic
1142114797 16:88351057-88351079 AAGGTCACAGCAGGTGTCCAGGG - Intergenic
1142629945 17:1218822-1218844 AAGTACACTGCAGTTTTCCAAGG - Intronic
1143123124 17:4621951-4621973 AAGGCCACTGCAGTGATCCAGGG - Intergenic
1145786424 17:27596922-27596944 GTGTCTACTGCAGATGTCCACGG - Intronic
1146285371 17:31571048-31571070 AAGGCAACTCCACTTGGCCAGGG - Intergenic
1146472281 17:33134228-33134250 AAGGTTAAGTCAGTTGTCCAAGG + Intronic
1146791843 17:35755330-35755352 TAGGCTACTGCAGTCATCCAGGG + Intronic
1147443698 17:40462402-40462424 AAGGCTACTCCAGGAGACCAGGG - Intergenic
1148290445 17:46443594-46443616 GAGGCTACTGCTGTAGTGCAAGG - Intergenic
1148312613 17:46661167-46661189 GAGGCTACTGCTGTAGTGCAAGG - Intronic
1148781161 17:50122896-50122918 GAGGAGATTGCAGTTGTCCAGGG + Intronic
1149889425 17:60373343-60373365 AAATCTACTGCAGTACTCCATGG - Intronic
1150514591 17:65794837-65794859 AAGACTATTGCAGTTGTCTTGGG - Intronic
1151434876 17:74089070-74089092 ACAGCTCCTGCAGTGGTCCAGGG - Intergenic
1153060979 18:994901-994923 AGAGCTACTGCAGTGGTCCAGGG + Intergenic
1154002562 18:10494750-10494772 AAAGCTAGTGCAGTTCTCTAGGG - Intergenic
1155099393 18:22594231-22594253 GAGGCCACTGCAGTTGTCTAGGG - Intergenic
1157777016 18:50403649-50403671 AGGACAACTGAAGTTGTCCAGGG + Intergenic
1160040783 18:75343677-75343699 ATGGTCACAGCAGTTGTCCAGGG + Intergenic
1163928262 19:20365315-20365337 AAGATGACTGAAGTTGTCCAGGG + Intergenic
1165253304 19:34557658-34557680 GAGACAACTGAAGTTGTCCAGGG - Intergenic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
1165522746 19:36327630-36327652 AAGGCGACTGAAGTCGTCCAGGG - Intergenic
925320790 2:2966072-2966094 AAGGTTAATTCACTTGTCCAGGG + Intergenic
926279181 2:11430943-11430965 AAGGCTTCTGAAGATGCCCAAGG - Intergenic
926643078 2:15258593-15258615 AAGGGTACTGCAGGAGACCAGGG - Intronic
928113065 2:28525911-28525933 AAGGCCACAGCAGGTGTGCATGG + Exonic
929003880 2:37376703-37376725 AAAGCTACTGCTGTGTTCCAAGG + Intergenic
929094542 2:38251015-38251037 AATGCCACTCCAGTTGCCCAGGG - Intergenic
929697237 2:44128576-44128598 ATGGCTGGTGCAGTTGTTCAAGG + Intergenic
931287720 2:60846705-60846727 GAGACTACTGCAGTAATCCAGGG - Intergenic
931553264 2:63470582-63470604 AAGGCTGTTGCCGTAGTCCAGGG - Intronic
932365774 2:71152427-71152449 AAGGCTGATGCAGTAATCCAAGG - Intergenic
932420371 2:71597856-71597878 GAGGTCACTGCAGTGGTCCAGGG - Intronic
932517097 2:72362682-72362704 AAGGCTATTGCAGTAATCTATGG - Intronic
933632482 2:84673382-84673404 TAGGCTACTGCAGTTGCCTCTGG - Intronic
934025746 2:88000335-88000357 ATGGCTCCTGCCCTTGTCCAGGG - Intergenic
937293521 2:120796335-120796357 GAGGCTACTGCAGTGACCCAGGG - Intronic
938389671 2:130894826-130894848 CAGGCTTATGCAGTTGTTCAGGG + Intronic
939341364 2:140899182-140899204 AAGGCTCCTGTTGTTGTCAAGGG + Intronic
940216346 2:151307530-151307552 GAGGCTACTGCAGTTGTCCAGGG - Intergenic
940793471 2:158052511-158052533 ATGGCTACTGTTGGTGTCCAGGG - Intronic
940890983 2:159035017-159035039 AAGGCTACTGTATGTGTTCATGG - Intronic
941792710 2:169570238-169570260 AAGGCTTCAGCAGTTGTACAAGG - Intronic
941889418 2:170563280-170563302 AAGGATAGTGTAGTTCTCCAAGG + Intronic
942484168 2:176422059-176422081 AAGACTTCTGAAGTTGTCCTGGG + Intergenic
944417520 2:199493501-199493523 GAGGCTCCTGCCATTGTCCATGG + Intergenic
946546509 2:220749740-220749762 AGGGCTCCTGCAGTTTTCCAGGG - Intergenic
946769318 2:223072244-223072266 AAGGCCACTGCATTTCCCCATGG + Intronic
946914125 2:224498695-224498717 AAGGATCATGCAGTTGACCAGGG + Intronic
947003743 2:225487300-225487322 GAGGCTACGGCAGAGGTCCAGGG - Intronic
948000032 2:234560244-234560266 AAGACTGCTGCAGTTGTCCAGGG + Intergenic
948853264 2:240718579-240718601 CAGGCTCCTGAACTTGTCCAGGG + Intronic
1170157113 20:13279039-13279061 ATGGCTAATGCAGATCTCCAGGG + Intronic
1170413158 20:16112242-16112264 GAGACTACTGCAGCAGTCCAGGG - Intergenic
1173239519 20:41281916-41281938 AAGGCTATTGCAGAAGTCCTGGG + Intronic
1173429433 20:42973082-42973104 GAGGCTACCACAGTGGTCCAGGG + Intronic
1176458196 21:6931064-6931086 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1176836370 21:13796159-13796181 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1178174700 21:30083260-30083282 AAGGCTAAAGCAGCTTTCCATGG + Intergenic
1178597016 21:33963317-33963339 AAGGCTCCCGCAATTGTGCAAGG - Intergenic
1179081997 21:38179952-38179974 GAGGCTACTGCAATAGTCCAAGG + Intronic
1180636726 22:17267761-17267783 AGGGCTACGGCAGATGCCCAGGG + Intergenic
1185035363 22:48473396-48473418 AGGGATACTGCAGTTGTCTCGGG + Intergenic
952304008 3:32129543-32129565 GAGGCTAATGAACTTGTCCAGGG + Intronic
952890642 3:38037945-38037967 AAGAGGACTGCATTTGTCCAGGG - Intergenic
954959411 3:54550955-54550977 GAGGCTCCTGCAGTCATCCATGG - Intronic
955618691 3:60837243-60837265 AAGGCTTCTGCAGTTTTTCAAGG + Intronic
957767822 3:84648674-84648696 AAGCCTACTCCAGTGGACCAAGG + Intergenic
960364075 3:116749367-116749389 GAGGCTACTGCAGTAATCCAGGG + Intronic
961655721 3:128440586-128440608 AAGACTACTGCTGCTGCCCAGGG - Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962449528 3:135501018-135501040 AGGGCCATTGCAGTTGTCCTGGG + Intergenic
962463949 3:135639544-135639566 AAGAGGACTGCTGTTGTCCAGGG - Intergenic
962685718 3:137845891-137845913 GAGGCTACTGCACTGGCCCAGGG - Intergenic
962713147 3:138104016-138104038 AAGGCCACGGCAGTAGGCCAAGG + Exonic
962722181 3:138186395-138186417 AAGGCTATTGCTGTAGTCCAGGG + Intergenic
965421312 3:168462721-168462743 AAAGTTACTGCACTTGTCCAGGG - Intergenic
966671689 3:182534064-182534086 AAGGCTATTTCAGATTTCCATGG + Intergenic
971273097 4:25170144-25170166 GAGGCCACTGCATTTGTCCAAGG - Intronic
972730701 4:41791985-41792007 GAGGCTATTGCAATTGCCCAGGG - Intergenic
973963766 4:56139032-56139054 AATGCTAATGAAGTTGTCAAAGG + Intergenic
975794689 4:77994757-77994779 GGGGCAACTGCAGTTGTGCAGGG + Intergenic
976971128 4:91104058-91104080 AAGGGTACTGCAGGAGACCAGGG - Intronic
979467292 4:121055269-121055291 AAGGCTACTGCAGTTGTCCATGG + Intronic
981111667 4:140941681-140941703 AAGGCTACTGCAGAAAGCCAGGG + Intronic
981120805 4:141049000-141049022 ATGGCCAGTGCAGTTGTTCATGG + Intronic
981607901 4:146559397-146559419 AATGCTACTGCCATTTTCCAAGG + Intergenic
982922338 4:161291427-161291449 AAGGATACTGCAGGAGACCAGGG - Intergenic
983501779 4:168507588-168507610 AAGGCTTGTGCAGTAATCCAGGG - Intronic
989122119 5:38015330-38015352 AAGGCTAATGCTGTTGGTCAGGG + Intergenic
990696200 5:58420240-58420262 AAGACTATTGCAGTGATCCAGGG + Intergenic
990931228 5:61094717-61094739 AGGGCTACTGCAGTTTTCTGGGG + Intronic
991143347 5:63272991-63273013 AAGGCTGCTGCAGTTTTCTCAGG + Intergenic
992081650 5:73239251-73239273 AAGGCTACTGCAGAACTGCAGGG + Intergenic
993870467 5:93247320-93247342 TAGGCTACTGCAGTTGCCTGAGG - Intergenic
994081274 5:95711072-95711094 AAGGCGACTGAAGTCATCCAGGG - Intergenic
994919529 5:106025544-106025566 AAGCCTAGTGCATTTGTACAGGG + Intergenic
996971736 5:129377772-129377794 AATTCTACTTGAGTTGTCCATGG - Intergenic
1001322086 5:170691092-170691114 AAGGCTACAGCATTTCTCTATGG + Intronic
1001739027 5:174034842-174034864 AGGGCTGCTGCAGTTTTCCGGGG + Intergenic
1002364529 5:178699795-178699817 AATGCAACAGCTGTTGTCCATGG - Intergenic
1004194813 6:13493852-13493874 AAGGCTACTGCGGTAGTCCAAGG - Intergenic
1004760213 6:18657260-18657282 AGGGCTGCTGCAGTTTGCCAGGG - Intergenic
1005864524 6:29927711-29927733 AAGGCTGCTGCTGGTGTCAAAGG - Intergenic
1005866941 6:29943801-29943823 AAGGCTGCTGCCGGTGTCAAAGG - Intronic
1006052590 6:31355908-31355930 AAGGCTGCTGCAGGGGTCAAAGG + Intronic
1007166590 6:39832749-39832771 AGGGTTTCTGCAGTTCTCCACGG + Intronic
1007268038 6:40611989-40612011 CAGGCTACTGCAGTGGTCAGAGG + Intergenic
1007353512 6:41292914-41292936 AAGGCTGGTGCAGTTGTCAGAGG - Intergenic
1007685395 6:43664580-43664602 AGGGCTACTGCAGTGCCCCAGGG + Intronic
1007698961 6:43754426-43754448 AAGGCTAAGGCAGGAGTCCAAGG - Intergenic
1008309004 6:49941767-49941789 AAGGCTATTGCAATGATCCAGGG - Intergenic
1009720179 6:67458445-67458467 GAGGGTACTGCAGTAGACCAGGG + Intergenic
1011356377 6:86476395-86476417 AAGACAACTGAAGTTGTCCAGGG + Intergenic
1013160038 6:107534363-107534385 AAGGCTACAGCAGTTCTTTAAGG - Intronic
1013514257 6:110871365-110871387 AAAGCTACTGCAATAGTTCAGGG + Intronic
1013650933 6:112193708-112193730 GAGGCTACTTCAGTTTTCCAGGG + Intronic
1014671234 6:124306287-124306309 AAGGCTATTGCAGTGTTCCCTGG - Intronic
1016448009 6:144152558-144152580 AAGGTGACTGCAATTGTCCAGGG - Intronic
1017086074 6:150714128-150714150 AAGCCTACTGCATTCTTCCAGGG + Intronic
1017809473 6:157974579-157974601 GAGGCTGCTGCCGTTGCCCAGGG - Intergenic
1020717594 7:11695921-11695943 GAGGCTATTGCAGTGGCCCATGG + Intronic
1021852027 7:24817697-24817719 GAGGCTACTGCAATTGCCCAGGG + Intronic
1022359219 7:29642966-29642988 AAGACAACTGAAGTTGTCCAGGG - Intergenic
1025116130 7:56259999-56260021 GAGGCTGCAGCAGATGTCCAGGG + Intergenic
1028666505 7:93349516-93349538 AAGGCTGCTGCAGTATTGCAGGG + Intronic
1030252478 7:107463051-107463073 AAAGCTGATGCAGTTGTTCAGGG - Intronic
1032521809 7:132551094-132551116 GAGGCTGCTGCTGTGGTCCAAGG - Intronic
1032775878 7:135112185-135112207 GAGGCTAATGCAGTTATTCAAGG - Intronic
1033993935 7:147321992-147322014 AAGGCTAATGCAGTGTTCCATGG + Intronic
1036106099 8:5842132-5842154 CTGGCTACTGCAGTGGTCCCAGG + Intergenic
1036145193 8:6248442-6248464 AAGGCTTCTGCAGCTCACCAGGG + Intergenic
1038190441 8:25314957-25314979 GAAGCTACGGCAGTTGTCCAGGG - Intronic
1039658297 8:39433906-39433928 AAGGCTGCTGCAGTTTTCTGGGG - Intergenic
1040109007 8:43557852-43557874 AAGACAACTGAAGTTGTCCAGGG - Intergenic
1040787720 8:51185839-51185861 AAGGTTTCTGAAGTTGTCAAAGG + Intergenic
1042203735 8:66307222-66307244 AAGTCTGCTGGGGTTGTCCAAGG + Intergenic
1043919839 8:85968746-85968768 AAGGCTGCAGCAGCTATCCAAGG + Intergenic
1045159449 8:99522097-99522119 AAGAATACTGTAGTTGTCCCTGG + Intronic
1046893133 8:119445010-119445032 AAGGCTCCTGAAATGGTCCAGGG - Intergenic
1047084834 8:121505117-121505139 GAGGCCATTGCAGCTGTCCAGGG - Intergenic
1047101491 8:121681029-121681051 AAGACTACTGAAAGTGTCCAGGG - Intergenic
1047282253 8:123455772-123455794 AAGTCTACTGCAGGTGTTCTGGG + Intronic
1048736096 8:137503773-137503795 AAGGCTACTTCTTTTGTCTATGG - Intergenic
1048863183 8:138739013-138739035 AAGGCTACTGCAGTGGTTCTGGG - Intronic
1049075638 8:140394181-140394203 AAGGCAACTCCAGTTGTTAACGG + Intronic
1049409291 8:142465237-142465259 AAGGTCACTGCAGGTGTGCAGGG + Intronic
1051705548 9:19875905-19875927 AAGGCTTCTCCAGTTGTGCATGG + Intergenic
1051971189 9:22889775-22889797 AAGGGTGCTTCAGGTGTCCATGG - Intergenic
1053276341 9:36786468-36786490 AGGGCTATTGCAGTTGTAGATGG + Intergenic
1055455364 9:76466942-76466964 AAGGCTATTTCAGGTGTACAGGG - Intronic
1056082726 9:83113690-83113712 GAGGCTACTGCAGGAGACCAGGG - Intergenic
1056939289 9:90941447-90941469 GAGGCTGCTGCAGTTGTCCATGG - Intergenic
1057493714 9:95543246-95543268 TCGGCTATTGCAGATGTCCAAGG + Intergenic
1058887164 9:109330279-109330301 GAGGCCAGTGCAGTGGTCCAGGG - Intergenic
1059485248 9:114622023-114622045 GAGGCTACTGCAGAGGGCCAAGG + Intronic
1059941602 9:119365577-119365599 AAGGCCCCTTCAGTTGTGCAAGG - Intronic
1185970179 X:4654030-4654052 AACACTACTCCTGTTGTCCATGG - Intergenic
1187646233 X:21349504-21349526 AGGGCTACTGCAGTTTTTTAAGG - Intergenic
1187963959 X:24592536-24592558 GAGGCTACTGCAGTCATCCCTGG - Intronic
1190133157 X:47769211-47769233 AGGGCTGCTGCAGTTTTCCGGGG - Intergenic
1192286868 X:69747606-69747628 GAGGCTACTGCCTTTTTCCAAGG + Intronic
1192461803 X:71323424-71323446 AAGGTAATTGCAGTGGTCCAAGG + Intergenic
1193481660 X:82035342-82035364 AAGGCTACTGCAGGGGTCTTTGG + Intergenic
1193663444 X:84285632-84285654 AATGCTACTGAATTTGTACATGG + Intergenic
1194723266 X:97365282-97365304 AAGATTACTGCAGTAGTCCATGG - Intronic
1196755013 X:119150427-119150449 AAGGCTGTTGCAGTTGTCTTTGG - Exonic
1197455313 X:126671185-126671207 AAGGCTACTGCAGTTTTCTTGGG - Intergenic
1198272847 X:135071457-135071479 AAGAATACTGGAGTTGTCAAAGG + Intergenic
1199863090 X:151819795-151819817 GAGGCTACTGCAGCTGGCCTAGG + Intergenic
1200744410 Y:6891009-6891031 AAGATGACTGAAGTTGTCCAGGG + Intergenic
1200846254 Y:7834446-7834468 AAGACAACTGAAGCTGTCCAGGG + Intergenic