ID: 979468725

View in Genome Browser
Species Human (GRCh38)
Location 4:121071379-121071401
Sequence GGTCGGGCCAACCGAACTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979468724_979468725 -9 Left 979468724 4:121071365-121071387 CCAGAGCGGTTGGGGGTCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 979468725 4:121071379-121071401 GGTCGGGCCAACCGAACTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 30
979468716_979468725 14 Left 979468716 4:121071342-121071364 CCACGCAGAGGACAAATGAGGAG 0: 1
1: 0
2: 1
3: 14
4: 135
Right 979468725 4:121071379-121071401 GGTCGGGCCAACCGAACTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 30
979468714_979468725 18 Left 979468714 4:121071338-121071360 CCTACCACGCAGAGGACAAATGA 0: 1
1: 0
2: 0
3: 2
4: 89
Right 979468725 4:121071379-121071401 GGTCGGGCCAACCGAACTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979468725 Original CRISPR GGTCGGGCCAACCGAACTCC CGG Intronic
900173404 1:1281453-1281475 GGTGGGGCGAACCCAGCTCCCGG - Exonic
912492848 1:110071344-110071366 GGTCGGGCCAAGCCAACCCTGGG + Intronic
922155652 1:223038261-223038283 TGTGAGGCCAACAGAACTCCTGG - Intergenic
1062955228 10:1535801-1535823 GGTCGGGGCAAGGGAACTCAGGG - Intronic
1084267178 11:68010992-68011014 GCTCGGGCCAACCCAGCCCCGGG - Intronic
1112207844 13:97343091-97343113 GTTGGGACCAACCCAACTCCAGG - Exonic
1114055255 14:18962955-18962977 GGTCCTGCCAACCGGTCTCCTGG - Intergenic
1114107288 14:19438821-19438843 GGTCCTGCCAACCGGTCTCCTGG + Intergenic
1144447304 17:15342635-15342657 ACTCAGGCCAACCGAACTCATGG + Intergenic
1149722892 17:58863764-58863786 GGTTGGGACACCTGAACTCCAGG - Intronic
1162798442 19:13098341-13098363 GGTCGGGCGCACGGATCTCCCGG - Intronic
1162967446 19:14162615-14162637 GGTCGGGCGGCCCGAACTCCAGG + Exonic
1163411379 19:17156993-17157015 GGTCGGGCCACCCGAGGTGCTGG + Exonic
926142144 2:10374038-10374060 GGCCAGGCCACCCGAGCTCCAGG - Intronic
937293743 2:120797653-120797675 GGTCTGGCCACCCCAAGTCCAGG + Intronic
948413960 2:237787226-237787248 GGTCTGGCCACCCCAACACCTGG + Intronic
1179234265 21:39531053-39531075 GTTAGGGCCAACCCCACTCCAGG - Intergenic
1180473737 22:15685507-15685529 GGTCCTGCCAACCGGTCTCCTGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
953464408 3:43106092-43106114 GGCCAGGGCAACCGAACTCGCGG - Intergenic
960994592 3:123332526-123332548 GGTCAGGCCACCCCAACCCCCGG + Intronic
962960936 3:140310295-140310317 GGTGGGGCCAGCCAAACTTCAGG - Intronic
979468725 4:121071379-121071401 GGTCGGGCCAACCGAACTCCCGG + Intronic
981354660 4:143774429-143774451 GGTTGGGCGAACCTACCTCCAGG + Intergenic
983938110 4:173517125-173517147 GGCCGGGCCAACCGTCCCCCCGG + Intergenic
1002873369 6:1188041-1188063 GGTGGTGACAACTGAACTCCAGG - Intergenic
1024331012 7:48155457-48155479 GTTTGGGGCAACCGAAATCCTGG - Intergenic
1040293481 8:46137326-46137348 GGTCGGGCCACGGGAACTCAGGG - Intergenic
1053139934 9:35676006-35676028 GGTAGGGCCAGCCCAACCCCCGG - Intronic
1060972337 9:127745304-127745326 GGTGGGGCCATGCAAACTCCTGG - Intronic
1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG + Intronic
1200116169 X:153770636-153770658 GTTCGGGCCCACCCACCTCCTGG - Exonic