ID: 979468727

View in Genome Browser
Species Human (GRCh38)
Location 4:121071386-121071408
Sequence GCCGGGGCCGGGAGTTCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979468727_979468739 21 Left 979468727 4:121071386-121071408 CCAACCGAACTCCCGGCCCCGGC 0: 1
1: 0
2: 0
3: 7
4: 131
Right 979468739 4:121071430-121071452 CCAAGAACTCGTGCGCTGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979468727 Original CRISPR GCCGGGGCCGGGAGTTCGGT TGG (reversed) Intronic
900166843 1:1247309-1247331 GCCGGGGCCGTGAGTCAGGGCGG - Intergenic
901007979 1:6180723-6180745 GCCGGAGCCGGGAGCGGGGTGGG - Intergenic
901441350 1:9280375-9280397 GGCGGGGCGGGGAGTGGGGTCGG - Intergenic
903044008 1:20552671-20552693 GCCGGGGCTGGGGGTGAGGTGGG - Exonic
905816172 1:40952730-40952752 CCAGGGGCTGGGAGGTCGGTTGG - Intergenic
906292916 1:44631724-44631746 GCCGGGGCCGGGCGATGGGGCGG + Intronic
906295427 1:44646372-44646394 GCCGGGGCCGCGAGTGCTGCTGG + Intronic
919982492 1:202650980-202651002 GAAGGGGCCGGGAGTGGGGTGGG + Intronic
923650153 1:235866575-235866597 GCCGCGGGCGGGAGCTCGGCTGG - Intronic
1067944654 10:50682348-50682370 GCCTGGCCAGGGAGTTGGGTTGG + Intergenic
1069256542 10:66338282-66338304 GCCTGGGCCTGGAGGTCGGAAGG + Intronic
1069403635 10:68075372-68075394 GCCGGGGCCGGGAAGTGGGCGGG - Intergenic
1070328812 10:75403988-75404010 GCCGGGGAGGGGAGTCAGGTGGG - Intergenic
1070557456 10:77539572-77539594 GCAGGGGCCAGGAATTTGGTGGG - Intronic
1070866156 10:79709219-79709241 GCCTGGCCAGGGAGTTGGGTTGG + Intronic
1070879950 10:79847350-79847372 GCCTGGCCAGGGAGTTGGGTTGG + Intronic
1071522824 10:86341508-86341530 GCCGTGGCCGGGAGCCCTGTGGG - Intronic
1071633059 10:87231440-87231462 GCCTGGCCAGGGAGTTGGGTTGG + Intronic
1071646508 10:87363658-87363680 GCCTGGCCAGGGAGTTGGGTTGG + Intronic
1074165617 10:110871833-110871855 GCCGAGGCCGGGTGGTCGGCTGG - Exonic
1074455033 10:113589121-113589143 ACCGGGGCCGGGAGTGGGGGTGG - Exonic
1074818537 10:117163012-117163034 GCGGGGGCCGGGATTCCGGGCGG - Intergenic
1078334166 11:10450871-10450893 GCGGGGGCCGGGCGTTCAGAGGG - Exonic
1084423512 11:69072079-69072101 GCAGGGGCCGGGTGTTCATTAGG + Intronic
1089688036 11:120169305-120169327 GCCGGGGCCGTGGGGGCGGTGGG + Intronic
1091778633 12:3200334-3200356 GTCGGGGCCGGGATTTCGCAGGG + Intronic
1094125006 12:27014338-27014360 GCTGGGGCTAGGAGTTCGGCGGG - Exonic
1096749809 12:53751627-53751649 GGCTGGGCCGGGAGTGGGGTCGG + Intergenic
1102068662 12:109999635-109999657 GCCGGGGCCGAGACTTGGGGCGG + Exonic
1104367525 12:128191468-128191490 GCCGGGGCGTGGAGTGCGGACGG - Intergenic
1104890574 12:132137885-132137907 GCCGGGGCCGGGAGTTGGTGGGG - Exonic
1105997591 13:25687147-25687169 GCCGGGGTCAGGAGTTCAGGAGG + Intronic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1117388543 14:55240977-55240999 GGCGGGGCCGGGGGTTGGGGCGG + Intergenic
1118630183 14:67695495-67695517 GGCGGAGCCCAGAGTTCGGTGGG - Intronic
1123735752 15:23180723-23180745 GCCGGGGCCCGGGCTTCTGTAGG + Intergenic
1124286466 15:28403706-28403728 GCCGGGGCCCGGGCTTCTGTAGG + Intergenic
1124296237 15:28507930-28507952 GCCGGGGCCCGGGCTTCTGTAGG - Intergenic
1129348217 15:74937919-74937941 GGCGGGGCCGGGGGTCCGGGCGG + Exonic
1129380075 15:75159031-75159053 GCCAGGGCTGGGAGTAGGGTTGG + Intergenic
1129424103 15:75452158-75452180 GCCTGGCCCGGCAGTGCGGTAGG - Intronic
1129539297 15:76338010-76338032 GCCGGGGCCGGGACTGGGGATGG + Intronic
1131054603 15:89368131-89368153 GCCGGGCCGGGGCGGTCGGTGGG - Intergenic
1132600036 16:769203-769225 GCCGGGGCCGGGGTTGGGGTTGG - Intergenic
1132865073 16:2089302-2089324 GACGGTGCAGGGAGTACGGTAGG + Exonic
1136229869 16:28879863-28879885 CCCGGAGCCCGGAGTTCGGGTGG - Intronic
1136377263 16:29872800-29872822 GGAGGGGCCGGGAGCCCGGTGGG + Intronic
1138335914 16:56252756-56252778 GCCGGGGCCAGGAGGAAGGTTGG - Intronic
1138576799 16:57912504-57912526 GACGGGGCCTGGAGGTCAGTGGG + Intronic
1139475761 16:67201886-67201908 GCAGGGGTGGGGAGTTGGGTAGG - Intronic
1139534530 16:67563057-67563079 GCCGCGGCCGGGCGATCGGCCGG - Intronic
1140442511 16:74998894-74998916 GCCGGGGGCGGGCGGTGGGTGGG + Intronic
1141655873 16:85416301-85416323 CCCGGGGCCGGGAGCTGGGAGGG + Intergenic
1142163313 16:88570571-88570593 GCTGGGGCCGGGAGGGCGGCGGG + Intronic
1142694935 17:1628414-1628436 GCCGGGGCGGGCCGTTCCGTAGG - Intronic
1143172456 17:4938120-4938142 GCCTGGGCCTGGAGGTGGGTGGG - Intronic
1143174625 17:4949001-4949023 GCCGGGGCCGGGAGTGCATGGGG + Exonic
1143483393 17:7239447-7239469 GCCCGGTCCGGGAGTGCGGGAGG - Exonic
1147720397 17:42536318-42536340 GCCGGGGCCGGGGGCGCGGCAGG + Exonic
1155508003 18:26549868-26549890 GCCGGGGGCGGGCGTTTGGCTGG - Intronic
1161959584 19:7516276-7516298 GCCGGGGCGGGGGGCTGGGTGGG + Intronic
1163427356 19:17246605-17246627 GCCGGGGCCGCGAGGTCAGGGGG + Intronic
1163602672 19:18258250-18258272 GCTGGCCCCGGGAGTTCGGAGGG - Intronic
1165890625 19:39110189-39110211 GCCTGGGTGGGGAGTTGGGTGGG + Exonic
1166361164 19:42253645-42253667 GCCGGGGTGCGGAGTGCGGTAGG - Intronic
1167376420 19:49114571-49114593 GCCGGGGCCGGGCGGTCGCTAGG + Intronic
1167493009 19:49802610-49802632 GCCTGGGGTGGGAGGTCGGTCGG + Intronic
1168059657 19:53883616-53883638 GGCGGGGCCGGCAGTTCTGGGGG + Intronic
1168251744 19:55145984-55146006 GCCGGGGGCGGGGGGGCGGTGGG - Intronic
925183876 2:1833972-1833994 CCCGGGGCCGGGAGTGGGCTGGG + Intronic
929242315 2:39665767-39665789 GCCGGGGGCGGGCGGGCGGTGGG + Intronic
932176569 2:69608266-69608288 GCCTGGGCAGGGAGCTGGGTGGG - Intronic
944203736 2:197135738-197135760 GCAGGGGCCGGGAGGCTGGTGGG - Intronic
948698016 2:239743203-239743225 GCCGGGGCTGGGTGTAGGGTTGG - Intergenic
948770248 2:240248110-240248132 GCCGGGGCTGGGGGTTGGGCTGG + Intergenic
1171430647 20:25081575-25081597 GCTGGGGCCAGGGGTGCGGTGGG + Intronic
1173454094 20:43189772-43189794 GCCGGGGCCGGGACTGGGGCGGG + Exonic
1176005867 20:62861928-62861950 GGCGGGGCCGGGCGTGCGGGCGG - Intergenic
1176549306 21:8214507-8214529 GGCGGGGCCGGGGGTGGGGTCGG + Intergenic
1176557199 21:8258730-8258752 GGCGGGGCCGGGGGTGGGGTCGG + Intergenic
1176568238 21:8397545-8397567 GGCGGGGCCGGGGGTGGGGTCGG + Intergenic
1176576141 21:8441765-8441787 GGCGGGGCCGGGGGTGGGGTCGG + Intergenic
1180201945 21:46229410-46229432 GCCGGGGCCGGGGGTGGGGGCGG + Intergenic
1181282835 22:21731974-21731996 GCCGGGGCCGGGATTCCTGGTGG - Intronic
1183524750 22:38316731-38316753 GCCGGGGCCGGGAGAGCAGGGGG + Intronic
1203254191 22_KI270733v1_random:130823-130845 GGCGGGGCCGGGGGTGGGGTCGG + Intergenic
1203262247 22_KI270733v1_random:175902-175924 GGCGGGGCCGGGGGTGGGGTCGG + Intergenic
950023630 3:9806302-9806324 GCGGCGGCAGGGAGTTGGGTTGG + Exonic
950683985 3:14603212-14603234 GCCGGGGGCGGGATGGCGGTGGG + Intergenic
950759354 3:15206603-15206625 GCCGGGCCCGGCGCTTCGGTCGG + Intronic
954391570 3:50270509-50270531 GCCCGGGCCGGGAGTGGGGAGGG + Intronic
961044895 3:123701372-123701394 GCCGGGGCCAGGAGGAAGGTGGG + Intronic
961335815 3:126179249-126179271 GCCTGGGCTGGGAATTGGGTAGG - Intronic
962751177 3:138435580-138435602 GCCGAGGCCTGGACTGCGGTAGG + Intronic
968095992 3:195931261-195931283 GGTGGGGCCGGGGGTTGGGTGGG - Intergenic
968879694 4:3292772-3292794 GCCGGGGGCGGGACTTCCGTTGG - Intergenic
979468727 4:121071386-121071408 GCCGGGGCCGGGAGTTCGGTTGG - Intronic
985629931 5:1008980-1009002 GCCGGGGCCGGGAGCCCGCGGGG - Exonic
997521724 5:134527559-134527581 GGCGGCGCCGGGAGGTGGGTGGG - Intronic
1000148102 5:158472784-158472806 GGCGAGGACGGGAGTTCTGTTGG - Intergenic
1002100055 5:176853182-176853204 GCCGGGGCCAGGAGTGGGGCAGG - Intronic
1002185915 5:177454764-177454786 GCGGGGGCCGGGAAGTCGTTGGG + Intronic
1002209845 5:177592125-177592147 GCCGGGACCGCGAGTTCCGCCGG - Intergenic
1002261028 5:177994234-177994256 GGCGGCGCCGGGAGTGCGGGCGG + Exonic
1002670297 5:180861180-180861202 GCCGGGGGCGGGAGCGCGGGCGG + Intronic
1002720939 5:181261230-181261252 GCGCGGGCCGGGAGTTGGGTGGG + Intergenic
1004424689 6:15499313-15499335 GCCGCTGGCGGGAGTTGGGTGGG + Intronic
1005765891 6:29011714-29011736 GGCGGGGCGGGGAGGTGGGTAGG + Intergenic
1006155198 6:32009925-32009947 CCCGGGGCCGGGGGCTGGGTGGG - Intergenic
1006161504 6:32042659-32042681 CCCGGGGCCGGGGGCTGGGTGGG - Intronic
1006393982 6:33775104-33775126 GCCAGGGCCAGGAATTGGGTGGG + Intronic
1007516802 6:42419250-42419272 GCCGGGGCGGGGGGTGGGGTGGG - Intronic
1007644593 6:43370055-43370077 GCTGGGGACAGGATTTCGGTGGG - Intergenic
1019714420 7:2531810-2531832 GCCGGTGCCCGGAGCTCGATCGG + Intergenic
1019741900 7:2679238-2679260 GCCGGCGCCCGGAGCTCGATCGG - Intergenic
1020247107 7:6438189-6438211 ACCGGGGCCTGTAGTTGGGTGGG + Intronic
1020256690 7:6506401-6506423 GCTGGGGCAGGGAGTGCGGACGG + Intronic
1021979351 7:26039550-26039572 GCAGGGGGCGGGTGTTCGGGGGG + Intergenic
1022066574 7:26864644-26864666 GCCGGGGCGGGGAGATGGGTGGG + Exonic
1023773716 7:43583428-43583450 GCCCGGGCCGGGAGCTGGGCAGG + Exonic
1026732665 7:72925189-72925211 GCCGGGGCCGGGGCTGCGGCGGG + Intronic
1027111400 7:75442630-75442652 GCCGGGGCCGGGGCTGCGGCGGG - Intronic
1029207520 7:98878493-98878515 GCCGGGGCCTGGTGCTCGGTCGG + Exonic
1029440502 7:100584427-100584449 GCCGGGGGCGGGAGCTGGGAGGG + Intronic
1032838001 7:135691431-135691453 GCGGGGGCCGGGAGGGGGGTGGG + Intronic
1034491120 7:151393619-151393641 GAAGGGGCCAGGAGTTCGCTGGG - Intronic
1035022721 7:155808758-155808780 GCCGGGGCCGGGCTTTGTGTCGG + Intronic
1037261813 8:17018103-17018125 GCCGAGGCAGGGAGATCGCTTGG - Intergenic
1038540595 8:28386689-28386711 GCCGCGGACGGGAGCTCGGCTGG + Intronic
1042190056 8:66177369-66177391 GCCGGTCCCGGGAGCTCGGCAGG - Exonic
1042591982 8:70404471-70404493 GGCAGGACCGGGAGTTGGGTAGG - Intergenic
1048291164 8:133182867-133182889 GCCTGGGCCGGGGGTTGGGGTGG - Intergenic
1049389551 8:142360819-142360841 GCTGGAGCCGGGAGCCCGGTGGG - Intronic
1062571697 9:137188791-137188813 GCCGGGACGGGGAGGTCGGGAGG + Intronic
1203470592 Un_GL000220v1:113967-113989 GGCGGGGCCGGGGGTGGGGTCGG + Intergenic
1203478413 Un_GL000220v1:157939-157961 GGCGGGGCCGGGGGTGGGGTCGG + Intergenic
1185610837 X:1392822-1392844 GCCGGGGCTGGGGGTTCCGTGGG + Intergenic
1198651079 X:138864505-138864527 ACCTGGGCCAGGACTTCGGTTGG - Intronic
1199967314 X:152831046-152831068 GTCCGGGCCTGGAGTTCAGTGGG + Exonic