ID: 979468862

View in Genome Browser
Species Human (GRCh38)
Location 4:121072034-121072056
Sequence CGCACACCACACCACGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979468862_979468875 29 Left 979468862 4:121072034-121072056 CCCTCCCCGTGGTGTGGTGTGCG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 979468875 4:121072086-121072108 GATGCTAAGCACCAATATCCAGG 0: 1
1: 0
2: 0
3: 2
4: 79
979468862_979468867 -4 Left 979468862 4:121072034-121072056 CCCTCCCCGTGGTGTGGTGTGCG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 979468867 4:121072053-121072075 TGCGAAATAGTCCACGTCCCCGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979468862 Original CRISPR CGCACACCACACCACGGGGA GGG (reversed) Exonic
907428282 1:54395244-54395266 GGCACAGCCCACCATGGGGACGG - Intronic
912936099 1:114004912-114004934 CTCACTCCTCACCAAGGGGACGG + Intergenic
913195601 1:116453993-116454015 CCATCACCACACCAGGGGGAGGG - Intergenic
914971383 1:152310305-152310327 GCCACACCACACCCCAGGGAAGG - Exonic
922724714 1:227917513-227917535 CGCCCACCACAGCACCGGGGAGG - Intergenic
923052246 1:230396827-230396849 CGCACACAATCCCATGGGGAGGG - Intronic
923845867 1:237731913-237731935 CACACACCCCACAACAGGGAAGG + Intronic
923861786 1:237898930-237898952 CACAGACCACAGCAGGGGGAAGG - Intergenic
1072529087 10:96301447-96301469 AGCACACTACACCACTGGGCTGG + Intergenic
1080019583 11:27546029-27546051 GGCACACTACACCAGGGGGCTGG + Intergenic
1081436594 11:43033993-43034015 GGCATACCACACCACAGGGCAGG + Intergenic
1085277979 11:75312161-75312183 AGCTCACCACTCCCCGGGGAGGG - Intronic
1089610167 11:119664522-119664544 CGAACACAACACCATGGGGAAGG + Exonic
1091490199 12:926145-926167 CTCACTCAACACCAAGGGGATGG - Intronic
1092751749 12:11725698-11725720 CACTCACCCCACCACAGGGAGGG - Intronic
1095534958 12:43234265-43234287 AGCATACTACACCACGTGGAAGG - Intergenic
1097354558 12:58586760-58586782 CTCACCCCACAACATGGGGAAGG - Intronic
1103674764 12:122646960-122646982 AGCACATGGCACCACGGGGAAGG - Intergenic
1112489673 13:99850459-99850481 TGCACATCACACCACTAGGATGG + Intronic
1114773496 14:25455533-25455555 CCCAAACCACATCAGGGGGAAGG - Intergenic
1117642415 14:57813821-57813843 CGCAGGCCACACCACAGGAAGGG + Intronic
1119998349 14:79277694-79277716 GGGACACCACAGCAAGGGGAAGG - Intronic
1120909092 14:89649286-89649308 GGCACACAACCCCACAGGGACGG + Intergenic
1125751489 15:42032377-42032399 TGCCCACCACCCCACAGGGAAGG + Intronic
1128108221 15:65059640-65059662 CACAGACCACACCTCGGGGGTGG + Intronic
1132249647 15:100325580-100325602 CTCACTCATCACCACGGGGATGG - Intronic
1134783760 16:16922530-16922552 CTCACATTACACCACGGGGAGGG - Intergenic
1138145631 16:54608076-54608098 TGCACACCACAACACCAGGATGG - Intergenic
1138590771 16:57998615-57998637 CACAAACCACACATCGGGGAAGG + Intronic
1138596764 16:58033215-58033237 TGCCCAGCACAGCACGGGGAAGG - Intronic
1139642014 16:68298561-68298583 CAGCCACCACACCTCGGGGAAGG - Exonic
1140326209 16:74005652-74005674 CACACACCACATCAGGGGCATGG - Intergenic
1142104811 16:88296845-88296867 CCCACACCCCACCGAGGGGAGGG + Intergenic
1142236172 16:88923636-88923658 CGCGCAGCACAGCTCGGGGAGGG + Intronic
1142480345 17:215032-215054 TGCCCTCCACACCCCGGGGACGG + Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1151291887 17:73156385-73156407 CGCTCACCCCACCCCGGGGCCGG + Intergenic
1151652513 17:75478813-75478835 CTCCCACCACACCAAGGGGAAGG - Intronic
1153654347 18:7269753-7269775 CTCACTCATCACCACGGGGATGG + Intergenic
1153858352 18:9173599-9173621 CCCCCACCACCCCACCGGGATGG - Intronic
1156586568 18:38437675-38437697 TGCAAACCCCACCAGGGGGAGGG + Intergenic
1157685181 18:49637614-49637636 CTCACTCATCACCACGGGGATGG - Intergenic
1161203601 19:3029097-3029119 CGCGCACCCCAACCCGGGGAGGG - Exonic
1161220665 19:3116654-3116676 CGAACACCAGAACCCGGGGACGG - Intronic
1162841994 19:13363575-13363597 CCCACTCCTCCCCACGGGGAGGG - Intronic
1165288968 19:34867834-34867856 AGGACACCACACTAGGGGGAGGG - Intergenic
1165758043 19:38305349-38305371 CGCTCACCGCACCAGGTGGAAGG + Exonic
925144587 2:1572302-1572324 CGCACACAACATCACAGGGATGG + Intergenic
925188548 2:1865419-1865441 CACACGCCACACCAAGGGAATGG - Intronic
926140810 2:10366816-10366838 CTCCCACCACAGCACGGTGAAGG + Intronic
934941508 2:98506416-98506438 CTCACACCACACCGCTGGGCTGG - Intronic
936026161 2:109032577-109032599 CCCACCCCACCCCATGGGGAGGG - Intergenic
936789436 2:116133747-116133769 CTCACCGCACACCACGGCGAGGG + Intergenic
946626198 2:221614354-221614376 CAGGCACCACACCACGGGAAAGG + Intergenic
948060594 2:235041051-235041073 CGCACACAACACCACCGAAATGG + Exonic
948124325 2:235553909-235553931 CACACGCCGCACCACGGGGTGGG - Intronic
948850090 2:240701574-240701596 CGCACGCCACTGGACGGGGAAGG + Intergenic
948906845 2:240983740-240983762 CGCACACGACACCACTGGCAGGG - Intronic
1168860612 20:1043742-1043764 CACACACCACACGACGTGGTAGG - Intergenic
1172032189 20:31989964-31989986 AGAACACCACACCTCAGGGAAGG - Intronic
1175401015 20:58699911-58699933 CCCAACCCACAGCACGGGGAGGG - Intronic
1179492033 21:41746876-41746898 CCCACACCACCCCAGGGAGACGG + Intronic
1180003332 21:45005054-45005076 CTCACTCTTCACCACGGGGATGG - Intergenic
1183692715 22:39399933-39399955 GACACACCCCACCACGGAGAGGG - Intronic
1184290920 22:43497782-43497804 CACACACCCCACCTGGGGGAGGG + Intronic
1184309760 22:43633711-43633733 TGCCCACCACACCGTGGGGAGGG - Intronic
950257964 3:11521445-11521467 CGCACAGCAGGGCACGGGGAAGG + Intronic
953701513 3:45199528-45199550 CCCACCCCACATCAAGGGGAGGG + Intergenic
954075233 3:48173611-48173633 CAGTCACCACCCCACGGGGATGG + Intronic
958814719 3:98902122-98902144 CGCACATCAGACCACTGGAAGGG + Intergenic
968393605 4:213037-213059 CTCACCCCACAGCCCGGGGAAGG - Intergenic
968419703 4:473731-473753 CTCACCCCACAGCCCGGGGAAGG + Intronic
969112383 4:4852063-4852085 CCCACACCCCACCCCGGGGTGGG + Intergenic
971455939 4:26843942-26843964 CTCACACATCACCAAGGGGATGG + Intergenic
979468862 4:121072034-121072056 CGCACACCACACCACGGGGAGGG - Exonic
982157602 4:152536638-152536660 CTCACCCCACGCCACGGGAAGGG - Intergenic
982417918 4:155158236-155158258 CTCACTCAACACCAAGGGGATGG - Intergenic
984615217 4:181889223-181889245 CGCACGCATCACCACGAGGATGG - Intergenic
985724714 5:1509953-1509975 CGCAGGCCACATCACGGGGACGG + Intronic
991803564 5:70401430-70401452 CGCGCACCACCCCGAGGGGACGG + Intergenic
997381199 5:133439773-133439795 AGCAGGCCACACCACTGGGAAGG + Intronic
997712852 5:136020619-136020641 CACACACCACACAACGGGGGTGG - Intergenic
1003644438 6:7903031-7903053 CACACACCATGCCACAGGGAAGG - Intronic
1004060136 6:12187356-12187378 CACTCACCACCCCACAGGGAGGG - Intergenic
1019625137 7:2012073-2012095 CCCACACCCCACCATGGGAAGGG + Intronic
1022880994 7:34587232-34587254 AGCATACCACACCATGGGGTTGG + Intergenic
1023826314 7:44012289-44012311 CCCAGATCACACCACGGGCATGG - Intergenic
1026724404 7:72859350-72859372 CCCAGATCACACCACGGGCATGG + Intergenic
1026746564 7:73017707-73017729 CCCAGATCACACCACGGGCATGG + Intergenic
1026750216 7:73045850-73045872 CCCAGATCACACCACGGGCATGG + Intergenic
1026753863 7:73073960-73073982 CCCAGATCACACCACGGGCATGG + Intergenic
1026757514 7:73101996-73102018 CCCAGATCACACCACGGGCATGG + Intergenic
1027032667 7:74902265-74902287 CCCAGATCACACCACGGGCATGG + Intergenic
1027089890 7:75291490-75291512 CCCAGATCACACCACGGGCATGG - Intergenic
1027093535 7:75319418-75319440 CCCAGATCACACCACGGGCATGG - Intergenic
1027097178 7:75347385-75347407 CCCAGATCACACCACGGGCATGG - Intergenic
1027119482 7:75506473-75506495 CCCAGATCACACCACGGGCATGG - Intergenic
1027272343 7:76529138-76529160 CCCAGATCACACCACGGGCATGG + Intergenic
1027322170 7:77020285-77020307 CCCAGATCACACCACGGGCATGG + Intergenic
1027325802 7:77048204-77048226 CCCAGATCACACCACGGGCATGG + Intergenic
1029398287 7:100324386-100324408 CCCAGATCACACCACGGGCATGG - Intergenic
1029718013 7:102343559-102343581 CCCAGATCACACCACGGGCATGG + Intergenic
1029754601 7:102565686-102565708 CCCAGATCACACCACGGGCATGG - Intronic
1029772552 7:102664770-102664792 CCCAGATCACACCACGGGCATGG - Intronic
1033825420 7:145184076-145184098 CGCACTCCAAACCACGTGAAAGG + Intergenic
1048497783 8:134949423-134949445 CCCACCCCACACCCCTGGGATGG - Intergenic
1050027617 9:1352054-1352076 AGAACAACACACCAAGGGGAAGG - Intergenic
1057996330 9:99823966-99823988 CACACACTTCACCACCGGGAGGG + Intronic
1190344252 X:49322535-49322557 CGCACTCCACACCGCTGGGGGGG - Intronic
1190346442 X:49341645-49341667 CGCACTCCACACCGCTGGGGGGG - Intronic
1190354304 X:49589992-49590014 CGCACTCCACACCGCTGGGGGGG - Intronic
1192126950 X:68509976-68509998 TGCACACCACACCACACAGATGG - Intronic