ID: 979470651

View in Genome Browser
Species Human (GRCh38)
Location 4:121092189-121092211
Sequence GAGGTTTACCACTATGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979470648_979470651 -7 Left 979470648 4:121092173-121092195 CCTATTAACAGGATGGGAGGTTT No data
Right 979470651 4:121092189-121092211 GAGGTTTACCACTATGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979470651 Original CRISPR GAGGTTTACCACTATGTGGT GGG Intergenic
No off target data available for this crispr