ID: 979474020

View in Genome Browser
Species Human (GRCh38)
Location 4:121133811-121133833
Sequence ATTTGGACACAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979474015_979474020 18 Left 979474015 4:121133770-121133792 CCTTAATCCACTGTAACTGGTGT 0: 1
1: 9
2: 150
3: 773
4: 1705
Right 979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG No data
979474016_979474020 11 Left 979474016 4:121133777-121133799 CCACTGTAACTGGTGTGTGTGTA 0: 1
1: 0
2: 1
3: 23
4: 239
Right 979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979474020 Original CRISPR ATTTGGACACAGATGGAAGA TGG Intronic
No off target data available for this crispr