ID: 979474159

View in Genome Browser
Species Human (GRCh38)
Location 4:121135123-121135145
Sequence CACCATGTCCTGTCACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979474152_979474159 13 Left 979474152 4:121135087-121135109 CCCAGGCAGGAGGCCAGGGCTTA 0: 1
1: 0
2: 3
3: 46
4: 384
Right 979474159 4:121135123-121135145 CACCATGTCCTGTCACAGACTGG 0: 1
1: 0
2: 4
3: 18
4: 187
979474153_979474159 12 Left 979474153 4:121135088-121135110 CCAGGCAGGAGGCCAGGGCTTAG 0: 1
1: 0
2: 1
3: 37
4: 431
Right 979474159 4:121135123-121135145 CACCATGTCCTGTCACAGACTGG 0: 1
1: 0
2: 4
3: 18
4: 187
979474155_979474159 0 Left 979474155 4:121135100-121135122 CCAGGGCTTAGGTCTCCCTGTGC 0: 1
1: 0
2: 3
3: 18
4: 218
Right 979474159 4:121135123-121135145 CACCATGTCCTGTCACAGACTGG 0: 1
1: 0
2: 4
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979474159 Original CRISPR CACCATGTCCTGTCACAGAC TGG Intronic
900820605 1:4884378-4884400 CATCATGGACTGTCACACACTGG + Intergenic
901667962 1:10837178-10837200 CACCAGGTCCTGGCAGAGATGGG - Intergenic
902772491 1:18653650-18653672 CACCATGTCCAGGCACAGGTCGG + Intronic
904145803 1:28390499-28390521 CACCATGCCCTGCCCCAGCCTGG - Intronic
906586280 1:46981967-46981989 CACCAGGGCCTGTCATAGATGGG + Intergenic
907084742 1:51660897-51660919 CACCATGTCCTGTTAAGAACAGG + Intronic
919641147 1:200045262-200045284 CACCATGGCCTGGCACAGTTTGG + Intronic
924656644 1:245978670-245978692 CACCAAGGCCTGTAATAGACTGG - Intronic
1064983412 10:21186481-21186503 CACCATTTTATATCACAGACTGG - Intergenic
1066243027 10:33556276-33556298 TACAATGTCCTGACACAGATTGG - Intergenic
1066803935 10:39223798-39223820 CAACCTGTCCTATCACAGAATGG - Intergenic
1066805548 10:39248150-39248172 CAAAATGTCCTTTCACAGAATGG - Intergenic
1066805659 10:39249919-39249941 CAAAATGTCCAGTCACAGAATGG + Intergenic
1066807563 10:39276051-39276073 CAAGATGTCCTATCACAGAATGG + Intergenic
1068570400 10:58621615-58621637 CACCATGCCCTGCCCCAGGCTGG - Intronic
1069667397 10:70172053-70172075 AACCCTGTCCTGTCACAGAAAGG + Intergenic
1070302055 10:75210786-75210808 AACCCTGTCCTCTCCCAGACAGG - Intronic
1070756221 10:78994982-78995004 CACTATGTGATCTCACAGACTGG + Intergenic
1071075138 10:81740889-81740911 CACCAGGGCCTGTCACAGGGTGG + Intergenic
1074548854 10:114424394-114424416 CAAAATGTTCTGTCAAAGACAGG - Intergenic
1075734424 10:124655179-124655201 CACAGTGTCCTGTCACATTCAGG + Intronic
1079970725 11:27032093-27032115 CACCCTGCCCTGTCACTGATGGG + Intergenic
1081990021 11:47332702-47332724 TACCAAGTCCTGTCACCAACAGG - Exonic
1082308034 11:50607693-50607715 CAAGATGTCCTTTCACAGAAAGG - Intergenic
1084337339 11:68467049-68467071 GACATTGTCATGTCACAGACTGG + Intronic
1084480764 11:69418748-69418770 CATCAAGTCCTGTGGCAGACAGG - Intergenic
1085445503 11:76598229-76598251 CATCTTGCCCTGTCACAGACTGG - Intergenic
1085789761 11:79486884-79486906 CTCCAAGTCCTGTGACAGAAGGG - Intergenic
1087594521 11:100236348-100236370 CTCCATGTCCTGTTCCAAACTGG - Intronic
1087880981 11:103416135-103416157 CACCAGGGCCTGTCCCAGGCTGG + Intronic
1090421984 11:126581738-126581760 CACCATGTCCTGTAATAGACAGG + Intronic
1092055586 12:5505777-5505799 CACCAGGGGCTGGCACAGACTGG - Intronic
1092571136 12:9722764-9722786 AATCATGTCCTGCCAAAGACTGG - Exonic
1093504784 12:19852797-19852819 CACCCTATCCCTTCACAGACTGG + Intergenic
1096670684 12:53196685-53196707 CACCATGTGCTGTCCCTGACGGG - Exonic
1098304385 12:69087841-69087863 CACCATGTCATGTCCTGGACAGG - Intergenic
1101557885 12:105827752-105827774 CACCACGGCCTGTCAGGGACTGG + Intergenic
1101844756 12:108353909-108353931 CACCGTGCCCAGTCACACACAGG + Intergenic
1102191788 12:110994304-110994326 CTCCATGTCCTCACACAGCCTGG - Intergenic
1104004051 12:124879844-124879866 CACCATGCCCTGCCAAACACAGG + Intronic
1104297885 12:127534717-127534739 CCCCATTTCCTAACACAGACTGG - Intergenic
1104317726 12:127719856-127719878 CACCATGCCTGGTCACACACAGG - Intergenic
1104522049 12:129485274-129485296 CACCATCTCCTGTCAGTCACAGG + Intronic
1104722264 12:131051131-131051153 AACCACGTCCTGCCTCAGACGGG + Intronic
1105771028 13:23611817-23611839 CCCCAAGTCCTGGCACAGAGAGG - Intronic
1107213080 13:37881698-37881720 TGCCATGTCTTGTCACAGCCTGG + Intergenic
1107355637 13:39563327-39563349 CAGCATGGACTGTCACAGAGGGG - Intronic
1107567229 13:41617645-41617667 CACCAGGGCCTGTCACAGGGCGG - Intronic
1108464151 13:50697445-50697467 CACCATGTCCTTCCTCAGATGGG + Intronic
1109004123 13:56847249-56847271 AGCCATGTCATGTTACAGACGGG + Intergenic
1110120277 13:71871223-71871245 CTCCTTGTCCTGTCACTGAAAGG - Intergenic
1113030966 13:105993155-105993177 CACCATGCCCAGTCACAAGCAGG + Intergenic
1113908929 13:113832744-113832766 CAAGATGTCCTGCCACGGACGGG + Exonic
1115241202 14:31252517-31252539 CACCATGCCCGGCCTCAGACTGG - Intergenic
1116687090 14:48053448-48053470 CCCCCTGTCCTGTCATAGGCAGG + Intergenic
1116999887 14:51361578-51361600 CAGCGTGGCCTGTCACTGACAGG + Intergenic
1118683691 14:68269523-68269545 CTGAATGTCCTGTCTCAGACAGG + Intronic
1119713627 14:76842416-76842438 CACCCAGTCCTATCCCAGACTGG + Intronic
1121445669 14:93977344-93977366 GGCCATGTCCTGTCACATCCCGG - Intergenic
1122389340 14:101369688-101369710 CAGCATGTCCTGTGCCCGACTGG - Intergenic
1122629597 14:103101516-103101538 CTCCATGGCCTTTCACAGCCTGG + Intronic
1122780182 14:104140168-104140190 CACCCTGCCCTGCCCCAGACAGG - Intronic
1122794886 14:104201153-104201175 CACCACGGCCAGTCACACACGGG - Intergenic
1124584636 15:30993236-30993258 CACCATGTCCTCACACAGTGCGG + Intergenic
1129849888 15:78787768-78787790 CACAAGGTCCGGTCAGAGACAGG - Intronic
1130765646 15:86868086-86868108 CATCCTGACCTCTCACAGACCGG - Intronic
1132471332 16:105135-105157 ACCTATCTCCTGTCACAGACTGG - Intronic
1133562204 16:6960678-6960700 CAGCATCTCCTGTCTCTGACGGG + Intronic
1136074282 16:27806221-27806243 CACCATCTCCTGTCCCTCACAGG + Intronic
1136739748 16:32506716-32506738 CATAATGTCCTTTCACAGAATGG + Intergenic
1137002575 16:35242477-35242499 CAGCATGTTCTGTCAGATACAGG - Intergenic
1137012120 16:35331878-35331900 CATCATGTTCTGTCAGATACAGG - Intergenic
1137016469 16:35380640-35380662 CATCATGTTCTGTCAGATACAGG - Intergenic
1137018837 16:35402304-35402326 CACCATGTTCTGTCAGATACAGG - Intergenic
1137283494 16:46997759-46997781 CACCATGCCCAGTCATAGACTGG + Intergenic
1138403654 16:56770358-56770380 CACCATCTTCTTTCACAGCCTGG + Intronic
1140884238 16:79228925-79228947 CACCGTGCCCTGTCTCAGACTGG - Intergenic
1141002726 16:80323578-80323600 AAACATGTCCTCTCACAGTCTGG + Intergenic
1141016878 16:80459087-80459109 CACCTTGTCATGTTACAGATGGG - Intergenic
1141324005 16:83038515-83038537 CATCATGACCTTCCACAGACAGG - Intronic
1141649650 16:85386076-85386098 AACCCTGACCTGTCACAGAGAGG - Intergenic
1142122309 16:88392983-88393005 CGCCAGGTCCTGGCACAGAGAGG + Intergenic
1142278489 16:89135548-89135570 GACCACGTCCTGTCACAGAGAGG - Intronic
1203013167 16_KI270728v1_random:320621-320643 CATAATGTCCTTTCACAGAATGG - Intergenic
1203031502 16_KI270728v1_random:593780-593802 CATAATGTCCTTTCACAGAATGG - Intergenic
1203040219 16_KI270728v1_random:740651-740673 CATAATGTCCTTTCACAGAATGG + Intergenic
1146016228 17:29235934-29235956 CACCAGGGCCTGTCACACAGGGG - Intergenic
1146611902 17:34313492-34313514 CACCATGCCCTGTTACACAGTGG - Intergenic
1147420161 17:40318503-40318525 CCCCATGTCCTGCCCCAGATTGG + Intronic
1147955766 17:44133453-44133475 AACCATGCCCTTTTACAGACAGG - Intergenic
1148053821 17:44781861-44781883 CAGCATGGCCATTCACAGACAGG - Intergenic
1148346705 17:46908231-46908253 CAACGTGTCCTGACACTGACAGG - Intergenic
1151320567 17:73350017-73350039 CACCATGCCCAATCACAGCCTGG - Intronic
1152148231 17:78582209-78582231 AACTATGTGCTGGCACAGACTGG - Intergenic
1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG + Intronic
1155377381 18:25175192-25175214 CATCATGTCCTGTGACACACAGG - Intronic
1155809984 18:30220227-30220249 CACCATGGCCTGTCAGGGGCTGG + Intergenic
1156291576 18:35752654-35752676 GGACATGTCATGTCACAGACTGG - Intergenic
1158058937 18:53315119-53315141 CACCAGGTCCTGTCAGGGAGTGG - Intronic
1161648237 19:5467575-5467597 CACCATCTCCATTCACAGATGGG - Intergenic
1162981439 19:14242799-14242821 CACCATGCCCTGCCCCAGTCTGG - Intergenic
1163670622 19:18626064-18626086 CATGATGTCATGTCAGAGACAGG - Intergenic
1163847226 19:19644483-19644505 TACCATCTCATGTCACAGTCAGG - Intergenic
1166245944 19:41525695-41525717 CACCAGGTCCTGTCAGAGGGTGG + Intergenic
1168165389 19:54543585-54543607 CACCAGGCCCTCTCACAGACAGG + Exonic
925561004 2:5195463-5195485 AACCAAGTGCCGTCACAGACTGG + Intergenic
927294964 2:21443589-21443611 CACCATGTGAGGTCACAGCCAGG + Intergenic
927714578 2:25343204-25343226 CGCCATGTCCTGTGCCAGTCAGG - Intergenic
929361343 2:41094987-41095009 CACCAGGGCCTGTCAAGGACTGG + Intergenic
930377984 2:50591724-50591746 AACCATGTGCTGTCCCAGATAGG - Intronic
932193447 2:69761747-69761769 CATCTTGCTCTGTCACAGACGGG - Intronic
935000682 2:99011418-99011440 CACCATGCCCGGCCAAAGACAGG + Intronic
937605037 2:123789837-123789859 TACCAAGTCCTTTCAGAGACAGG + Intergenic
940152049 2:150613423-150613445 CCCCAAGTCCCGTCACAGAGAGG - Intergenic
945330184 2:208530145-208530167 GCCCAAGTGCTGTCACAGACCGG - Intronic
947705548 2:232272753-232272775 AACCATGTCCTCTATCAGACTGG + Intronic
948213996 2:236215397-236215419 CACCCTGTCCTCTGACAGTCCGG + Intronic
1170258681 20:14377424-14377446 CACCTTGTCCTGTCACTGTTTGG + Intronic
1170594127 20:17792725-17792747 CACCATGTTCGGTCACTGGCAGG - Intergenic
1170846901 20:19969851-19969873 AACACTGTCCTGACACAGACAGG - Intronic
1172108275 20:32529516-32529538 CAACACGTTCTGGCACAGACAGG + Intronic
1175136821 20:56830342-56830364 CACACTGTCCTGTCTCTGACAGG + Intergenic
1175380302 20:58558132-58558154 CTCCATGTCCTGGCACGGAGGGG + Intergenic
1176379876 21:6106965-6106987 CACCATGTTCTGGCACAGTCTGG + Intergenic
1176520685 21:7821886-7821908 CACCCTGTCCTGTCAGAGACTGG + Intronic
1177209382 21:18051084-18051106 CACCAGGTCCTGTCAGGGGCTGG - Intronic
1177669481 21:24207896-24207918 CACCAATTCCGGTCACAGAAGGG - Intergenic
1178654708 21:34451898-34451920 CACCCTGTCCTGTCAGAGACTGG + Intergenic
1179371405 21:40809219-40809241 CACCATGTCCCAGGACAGACTGG + Intronic
1179521711 21:41949973-41949995 CACCAGGGCCTGTCAGGGACTGG + Intronic
1179743598 21:43431272-43431294 CACCATGTTCTGGCACAGTCTGG - Intergenic
1179880677 21:44292192-44292214 GACCATGTCTTTTCACAGAGGGG - Intronic
1182031045 22:27159704-27159726 CACCTTCTCCAGTCACAGATGGG - Intergenic
1184210293 22:43031325-43031347 CACCATGCCCGGTCCCAGAGAGG - Intergenic
1185101860 22:48844841-48844863 CACGATGTCCTCTTACACACTGG + Intronic
952932680 3:38372490-38372512 CATCACTTCCTGTCACAAACTGG - Intronic
957527365 3:81394380-81394402 CACACTGTCCTGTACCAGACAGG + Intergenic
960639518 3:119812628-119812650 CAGCATGTGCTTTCATAGACAGG - Intronic
961087828 3:124084310-124084332 CACCATGACCTGTCACAGGGAGG - Intronic
961212968 3:125140046-125140068 CACCATGCCCTGCCTCAGAGTGG + Intronic
962467645 3:135675085-135675107 CACCAGCTCCTGTCACCAACTGG + Intergenic
965642689 3:170847254-170847276 CACCAGGGCCTGTCAGAGAGTGG - Intronic
966522905 3:180892944-180892966 CACCACATCCTATCACAGACGGG + Intronic
966918560 3:184597950-184597972 AACCTTGTCCTGTCCCACACAGG - Intronic
974790648 4:66683671-66683693 GACCAAGTCAAGTCACAGACAGG + Intergenic
977460892 4:97323863-97323885 AAATATGTCCTGTCACAGTCTGG + Intronic
979293929 4:119009597-119009619 CACCATGTTCTGTCAAATAATGG + Intronic
979474159 4:121135123-121135145 CACCATGTCCTGTCACAGACTGG + Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985811687 5:2094781-2094803 CACCTTGTCCTTTCCCAGCCAGG - Intergenic
986565320 5:9107825-9107847 TACCAGGTCCTCTCACACACTGG - Intronic
988064219 5:26214460-26214482 CACCAGGGCCTGTCAGAGAGTGG + Intergenic
988089216 5:26513851-26513873 CACCAGGGCCTGTCACAGGTTGG - Intergenic
989499540 5:42149738-42149760 CACCATCTGCTTTCACAGGCTGG - Intergenic
989848310 5:46174387-46174409 CAAAATGTCCTTTCACAGAATGG + Intergenic
989848930 5:46183341-46183363 CAAAATGTCCTTTCACAGAACGG + Intergenic
990751928 5:59025859-59025881 CACCTTGGCCTGTCATAAACAGG - Intronic
994451158 5:99945828-99945850 GACCGTCTCCTGTCACAGAGAGG + Intergenic
994970328 5:106729851-106729873 CACCATGACCTGTCATAGGGTGG + Intergenic
995427264 5:112039353-112039375 CACCAGGGCCTGTCACAGGATGG + Intergenic
996803401 5:127428112-127428134 CACCATGGCCTGCCTCAGTCTGG - Intronic
999664212 5:153895814-153895836 CAGCATGTCATGTTGCAGACTGG + Intergenic
1000739635 5:164951806-164951828 AACCATGTCCTTGCACAGTCTGG - Intergenic
1002031867 5:176435754-176435776 CTACATGTCCTGCCCCAGACTGG + Intergenic
1002175439 5:177398911-177398933 CACCATCTCCCCTCAAAGACTGG + Intergenic
1004221806 6:13753727-13753749 ACCCATGGCCTGTCACAGCCTGG - Intergenic
1007733335 6:43965148-43965170 CACCAGGTACTGCCACAGAGAGG - Intergenic
1009064230 6:58437950-58437972 CCAAATGTCCTGTCACAGAATGG - Intergenic
1009252108 6:61315588-61315610 CCAAATGTCCTGTCACAGAATGG - Intergenic
1018810587 6:167295247-167295269 CAGCATGTCCTGGCACAACCAGG - Intronic
1020249756 7:6458174-6458196 CACCATGTCCAGTTTCAGGCTGG + Intronic
1022774564 7:33512680-33512702 AACAATGTACTGTCACAGAAAGG - Intronic
1024011267 7:45268944-45268966 CACCATGTCATGTCAGTGATAGG - Intergenic
1026891825 7:73986694-73986716 CACCGTGCCCTGACACTGACAGG + Intergenic
1029276106 7:99405332-99405354 CACGATGTTCTGTCACAGCCAGG + Intronic
1029282667 7:99446526-99446548 CATCAGGTCCTGTCCCAGAAGGG + Intronic
1031320489 7:120320530-120320552 CACTTTATCCTGTCAAAGACAGG + Intronic
1031843259 7:126772778-126772800 CACCATGTCCTTAGACACACAGG + Intronic
1032215236 7:129952537-129952559 CACCATGTCATCTCCCAGTCCGG - Exonic
1035595977 8:858264-858286 CTCCACGTCCTTTCACAGCCTGG - Intergenic
1039570883 8:38585599-38585621 CAGCGAGTCCTGTCACAGATGGG + Intergenic
1042268439 8:66932192-66932214 CACCATGCCCAGCCACAAACAGG - Intergenic
1042284632 8:67094558-67094580 CACCAGGCCCTGCCACAGAAAGG + Intronic
1042607371 8:70558843-70558865 CCCCATGTACTGTCACATCCAGG + Intergenic
1043588135 8:81793676-81793698 CACCAGGGCCTATCACACACTGG - Intergenic
1044790157 8:95838788-95838810 CCCTATGCCCTGTCACAGACTGG + Intergenic
1045763097 8:105633846-105633868 CACTATTTCCTGAAACAGACAGG - Intronic
1048714974 8:137258276-137258298 CAGCATGCGCTGTCATAGACAGG - Intergenic
1051756999 9:20412504-20412526 CACCATGTCCTGACCCTGACTGG + Intronic
1053023928 9:34715228-34715250 CACCAGGTCCACTCACAGACTGG - Intergenic
1053458160 9:38247192-38247214 CACCATCTCCTGTTTCAGGCTGG - Intergenic
1054414075 9:64854656-64854678 CACCATAGCCTGTCTCACACAGG - Intergenic
1055991159 9:82107168-82107190 CCCCATTCACTGTCACAGACTGG - Intergenic
1056551348 9:87655618-87655640 CATGAGGTCCTGTCACATACTGG - Intronic
1056807041 9:89736909-89736931 AACCATGTCCTGAAACAGGCAGG - Intergenic
1057538063 9:95935437-95935459 CTCCAGGGCCTGTCACAGAGTGG - Intronic
1057882491 9:98803008-98803030 CACCATGCTCGGTCACTGACTGG + Intergenic
1058736603 9:107899745-107899767 GGCCATGTCCTGTCCCAGGCTGG + Intergenic
1059546406 9:115179591-115179613 CTCCAGCGCCTGTCACAGACTGG - Intronic
1061413316 9:130432516-130432538 CACCCTGTCCTGCCACCTACCGG + Exonic
1061546952 9:131309877-131309899 CCCCAGGTCCTATCACAGATCGG + Intergenic
1062172694 9:135144271-135144293 CACCAGGTCATTTCACAAACTGG + Intergenic
1187026081 X:15436908-15436930 CAGGATGTTCTGACACAGACAGG + Intronic
1188667164 X:32838402-32838424 CACCATGGCCTGTCAGAGGGTGG - Intronic
1189725445 X:43964173-43964195 CACAGAGTCCTATCACAGACTGG - Intronic
1189911956 X:45818922-45818944 CACCATGTCCAGCCTCAAACTGG + Intergenic
1190430219 X:50371638-50371660 CACCATGTCCTGGCCCACACTGG + Intronic
1191665486 X:63698048-63698070 CACCATGTCCAGGCACACATAGG - Intronic
1201377165 Y:13335174-13335196 CACCAGGGCCTGTCAAAGGCTGG + Intronic
1201681846 Y:16654780-16654802 CACCAGGTCCTGTCAGGGGCTGG - Intergenic