ID: 979475533

View in Genome Browser
Species Human (GRCh38)
Location 4:121152857-121152879
Sequence GCACCAGAGGCACAGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979475533_979475538 -7 Left 979475533 4:121152857-121152879 CCTGGCCACTGTGCCTCTGGTGC 0: 1
1: 0
2: 3
3: 33
4: 294
Right 979475538 4:121152873-121152895 CTGGTGCCTAATGGAGGAGTTGG 0: 1
1: 0
2: 2
3: 21
4: 188
979475533_979475540 15 Left 979475533 4:121152857-121152879 CCTGGCCACTGTGCCTCTGGTGC 0: 1
1: 0
2: 3
3: 33
4: 294
Right 979475540 4:121152895-121152917 GCACAAAAATCCTACCTTCATGG 0: 1
1: 0
2: 0
3: 26
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979475533 Original CRISPR GCACCAGAGGCACAGTGGCC AGG (reversed) Intronic