ID: 979475534 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:121152862-121152884 |
| Sequence | ATTAGGCACCAGAGGCACAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 407 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 39, 4: 367} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 979475534_979475540 | 10 | Left | 979475534 | 4:121152862-121152884 | CCACTGTGCCTCTGGTGCCTAAT | 0: 1 1: 0 2: 0 3: 39 4: 367 |
||
| Right | 979475540 | 4:121152895-121152917 | GCACAAAAATCCTACCTTCATGG | 0: 1 1: 0 2: 0 3: 26 4: 219 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 979475534 | Original CRISPR | ATTAGGCACCAGAGGCACAG TGG (reversed) | Intronic | ||