ID: 979475534

View in Genome Browser
Species Human (GRCh38)
Location 4:121152862-121152884
Sequence ATTAGGCACCAGAGGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979475534_979475540 10 Left 979475534 4:121152862-121152884 CCACTGTGCCTCTGGTGCCTAAT 0: 1
1: 0
2: 0
3: 39
4: 367
Right 979475540 4:121152895-121152917 GCACAAAAATCCTACCTTCATGG 0: 1
1: 0
2: 0
3: 26
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979475534 Original CRISPR ATTAGGCACCAGAGGCACAG TGG (reversed) Intronic