ID: 979475539

View in Genome Browser
Species Human (GRCh38)
Location 4:121152879-121152901
Sequence TTTGTGCCAACTCCTCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979475539_979475540 -7 Left 979475539 4:121152879-121152901 CCTAATGGAGGAGTTGGCACAAA No data
Right 979475540 4:121152895-121152917 GCACAAAAATCCTACCTTCATGG 0: 1
1: 0
2: 0
3: 26
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979475539 Original CRISPR TTTGTGCCAACTCCTCCATT AGG (reversed) Intronic