ID: 979475540

View in Genome Browser
Species Human (GRCh38)
Location 4:121152895-121152917
Sequence GCACAAAAATCCTACCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979475533_979475540 15 Left 979475533 4:121152857-121152879 CCTGGCCACTGTGCCTCTGGTGC 0: 1
1: 0
2: 3
3: 33
4: 294
Right 979475540 4:121152895-121152917 GCACAAAAATCCTACCTTCATGG 0: 1
1: 0
2: 0
3: 26
4: 219
979475539_979475540 -7 Left 979475539 4:121152879-121152901 CCTAATGGAGGAGTTGGCACAAA No data
Right 979475540 4:121152895-121152917 GCACAAAAATCCTACCTTCATGG 0: 1
1: 0
2: 0
3: 26
4: 219
979475534_979475540 10 Left 979475534 4:121152862-121152884 CCACTGTGCCTCTGGTGCCTAAT 0: 1
1: 0
2: 0
3: 39
4: 367
Right 979475540 4:121152895-121152917 GCACAAAAATCCTACCTTCATGG 0: 1
1: 0
2: 0
3: 26
4: 219
979475537_979475540 2 Left 979475537 4:121152870-121152892 CCTCTGGTGCCTAATGGAGGAGT No data
Right 979475540 4:121152895-121152917 GCACAAAAATCCTACCTTCATGG 0: 1
1: 0
2: 0
3: 26
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979475540 Original CRISPR GCACAAAAATCCTACCTTCA TGG Intronic