ID: 979479483

View in Genome Browser
Species Human (GRCh38)
Location 4:121199829-121199851
Sequence GTACCTGAGGACGGTTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979479476_979479483 23 Left 979479476 4:121199783-121199805 CCTAATCTTTTCAAGTGGCATCA 0: 1
1: 0
2: 1
3: 12
4: 223
Right 979479483 4:121199829-121199851 GTACCTGAGGACGGTTGTGTAGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979479483 Original CRISPR GTACCTGAGGACGGTTGTGT AGG Intronic
901524005 1:9807902-9807924 GTACCAGAGAAGGGTTGTGAAGG - Intronic
902932225 1:19739801-19739823 GTACCTGGGAATGGCTGTGTGGG - Intronic
903129655 1:21270423-21270445 GTACCTGAAGGAGGTGGTGTGGG + Intronic
912489886 1:110056755-110056777 GTCCCAGAGGACTCTTGTGTTGG + Intronic
1067252803 10:44601946-44601968 GCACCACAGGACGGATGTGTTGG + Intergenic
1072003344 10:91219163-91219185 GTACCTGAGGATGAATGTGGAGG - Intronic
1075719764 10:124577830-124577852 GTAGCTGAGTACAGTTGTGACGG - Intronic
1080625526 11:34027521-34027543 GAACCTGAGGAGGGGTCTGTGGG - Intergenic
1082294578 11:50423730-50423752 GTATCTGAGAAGGGTTGTTTGGG + Intergenic
1082294601 11:50424072-50424094 GTATCTGAGGAGGGTTATTTGGG + Intergenic
1097077708 12:56407606-56407628 GTACCTGGGGACTGGTGTCTTGG + Intergenic
1099446169 12:82754445-82754467 GTACTTCAGGCCGGGTGTGTTGG + Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1108563057 13:51665750-51665772 GAACCTCAGGCCGGGTGTGTTGG + Intronic
1113013033 13:105792984-105793006 ATACCTGAGGCCGGGTGTGGTGG + Intergenic
1113886302 13:113660355-113660377 GCTCCTGAGGACTGTTGGGTGGG - Intergenic
1120198947 14:81516298-81516320 GTCCTTGAGGACAGTTGTCTGGG - Intronic
1121459616 14:94064787-94064809 GAACCTGAGGAAGGTGTTGTGGG + Intronic
1125328616 15:38562278-38562300 GGACCTGAGGACAGTTCTGAGGG - Intronic
1133336985 16:5012615-5012637 CTACCTGAGGCCGGGTGTGGTGG + Intronic
1148657982 17:49302672-49302694 ATACATGAGGACGGGTGTGGTGG + Intronic
1150288832 17:63969928-63969950 GTACCTGAGGCCAGGTGTGGTGG - Intronic
1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG + Intronic
1160902192 19:1434137-1434159 GCTCCTGAGGTCGGCTGTGTGGG + Intronic
1161704125 19:5810398-5810420 GCAGCTGAGGCCGGTTGTGGTGG - Intergenic
1166068907 19:40376590-40376612 GAACCTGAGGACGGGTGTATAGG - Exonic
1166284273 19:41814180-41814202 GTCCCTCAGGAGGATTGTGTGGG - Intergenic
1168098386 19:54128286-54128308 GTACCTGGGGACGGGTGGGTGGG - Exonic
927555294 2:24026808-24026830 GAATCTGAGGAGGGTTTTGTGGG + Intronic
930331741 2:49993998-49994020 GTTCCTGAGGACAGTTCTCTTGG - Intronic
930372701 2:50524189-50524211 GTCCCTGAGGACGGGTGTGGTGG + Intronic
944766439 2:202869532-202869554 GTACCTGATAACGGATGGGTGGG + Intronic
946391042 2:219417373-219417395 GTACCTGAGGAGGCATGGGTGGG - Intergenic
948932556 2:241141508-241141530 GTGCCCGAGGAGGGTGGTGTGGG - Intronic
1170664183 20:18371956-18371978 GTACTTGAGGCCGGGTGTGATGG + Intergenic
1174526222 20:51173812-51173834 GTACCTGAGGCTGTTAGTGTAGG + Intergenic
1184234759 22:43177146-43177168 GTACCTGAGCCCAGGTGTGTAGG + Intronic
953622801 3:44547611-44547633 GGACCTGAGGACTGCTGTCTGGG + Intergenic
955918707 3:63931998-63932020 TTACCTGAGTACAGTTTTGTAGG + Intronic
958942495 3:100331553-100331575 CTACCTGTGGACGGTGGTGGTGG + Intergenic
968561485 4:1285495-1285517 GAACCTGAGGAAGGGTTTGTGGG + Intergenic
979479483 4:121199829-121199851 GTACCTGAGGACGGTTGTGTAGG + Intronic
986036203 5:3942658-3942680 GTAGATGAGGACAGTGGTGTAGG - Intergenic
1008935888 6:56991830-56991852 GTACCTGTGGAGGGGAGTGTGGG - Intronic
1016466072 6:144327015-144327037 GTACCTGAGAAGGGATGTTTCGG + Intronic
1018812386 6:167307458-167307480 GTTCCAGAGGACGGTTGAGATGG + Intronic
1018812417 6:167307670-167307692 GTTCCAGAGGACGGTTGAGATGG + Intronic
1019728885 7:2619130-2619152 GGACCTGAGGACGGTGGTCCAGG + Intergenic
1023199099 7:37674416-37674438 GTACCTCAGGTCTGTTGTTTTGG + Intergenic
1024337044 7:48219650-48219672 GCACCTGCAGACGGTTGTGGAGG + Intronic
1029408098 7:100389951-100389973 GACCCTGAGGCCGGTTGTGGTGG - Exonic
1032074011 7:128827715-128827737 GTTTCTGAGGACGGTTGCGGGGG + Intergenic
1034277068 7:149828715-149828737 GTACCTGAGCACAGGTGAGTGGG - Intergenic
1044668886 8:94658570-94658592 GTACCTGAGCACTGTTGAGAAGG + Intronic
1044794652 8:95884788-95884810 TTCCCTGAGGACAGTAGTGTCGG + Intergenic
1046641132 8:116733067-116733089 GAATCTGAGGAGGGTTTTGTGGG - Intronic
1051355660 9:16237896-16237918 GTACCAGAGGACGGCGGTGGCGG + Intronic
1052087342 9:24283905-24283927 GTACCTAAGAACGGTGGAGTTGG - Intergenic
1194505437 X:94728730-94728752 ATACCTGAGGCTGGGTGTGTTGG + Intergenic
1199706365 X:150428798-150428820 GTACCTGATGAAGATTGTGGTGG + Intronic