ID: 979480294

View in Genome Browser
Species Human (GRCh38)
Location 4:121208683-121208705
Sequence ACCCACTTTTAACAGCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979480294_979480296 18 Left 979480294 4:121208683-121208705 CCATTGGGCTGTTAAAAGTGGGT 0: 1
1: 0
2: 0
3: 2
4: 111
Right 979480296 4:121208724-121208746 CATTCTTTGTCTCTGGTTCCTGG 0: 1
1: 0
2: 6
3: 38
4: 383
979480294_979480295 11 Left 979480294 4:121208683-121208705 CCATTGGGCTGTTAAAAGTGGGT 0: 1
1: 0
2: 0
3: 2
4: 111
Right 979480295 4:121208717-121208739 AAAAATACATTCTTTGTCTCTGG 0: 1
1: 0
2: 1
3: 48
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979480294 Original CRISPR ACCCACTTTTAACAGCCCAA TGG (reversed) Intronic