ID: 979481849

View in Genome Browser
Species Human (GRCh38)
Location 4:121228480-121228502
Sequence CTGTAAATATCAATCCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979481847_979481849 7 Left 979481847 4:121228450-121228472 CCTCAACATTATCTTTTTCATTA No data
Right 979481849 4:121228480-121228502 CTGTAAATATCAATCCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979481849 Original CRISPR CTGTAAATATCAATCCTGGT TGG Intergenic
No off target data available for this crispr