ID: 979482557

View in Genome Browser
Species Human (GRCh38)
Location 4:121236643-121236665
Sequence CAGGCTACCCCCAAATAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979482557_979482564 30 Left 979482557 4:121236643-121236665 CCTGCCTATTTGGGGGTAGCCTG No data
Right 979482564 4:121236696-121236718 TTTGCTCATAAAGACAGCTGTGG No data
979482557_979482560 4 Left 979482557 4:121236643-121236665 CCTGCCTATTTGGGGGTAGCCTG No data
Right 979482560 4:121236670-121236692 TCCAGCAGCTGCACGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979482557 Original CRISPR CAGGCTACCCCCAAATAGGC AGG (reversed) Intergenic
No off target data available for this crispr