ID: 979484256

View in Genome Browser
Species Human (GRCh38)
Location 4:121252842-121252864
Sequence AATCAGTCATTGTGCTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979484256_979484259 -1 Left 979484256 4:121252842-121252864 CCCAGCCAGCACAATGACTGATT No data
Right 979484259 4:121252864-121252886 TGACAGAAGTGTGCTGTCTTTGG No data
979484256_979484262 20 Left 979484256 4:121252842-121252864 CCCAGCCAGCACAATGACTGATT No data
Right 979484262 4:121252885-121252907 GGGCATGGATTCTTGCAGTTTGG No data
979484256_979484260 0 Left 979484256 4:121252842-121252864 CCCAGCCAGCACAATGACTGATT No data
Right 979484260 4:121252865-121252887 GACAGAAGTGTGCTGTCTTTGGG No data
979484256_979484261 5 Left 979484256 4:121252842-121252864 CCCAGCCAGCACAATGACTGATT No data
Right 979484261 4:121252870-121252892 AAGTGTGCTGTCTTTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979484256 Original CRISPR AATCAGTCATTGTGCTGGCT GGG (reversed) Intergenic
No off target data available for this crispr