ID: 979484257

View in Genome Browser
Species Human (GRCh38)
Location 4:121252843-121252865
Sequence CAATCAGTCATTGTGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979484257_979484261 4 Left 979484257 4:121252843-121252865 CCAGCCAGCACAATGACTGATTG No data
Right 979484261 4:121252870-121252892 AAGTGTGCTGTCTTTGGGCATGG No data
979484257_979484260 -1 Left 979484257 4:121252843-121252865 CCAGCCAGCACAATGACTGATTG No data
Right 979484260 4:121252865-121252887 GACAGAAGTGTGCTGTCTTTGGG No data
979484257_979484262 19 Left 979484257 4:121252843-121252865 CCAGCCAGCACAATGACTGATTG No data
Right 979484262 4:121252885-121252907 GGGCATGGATTCTTGCAGTTTGG No data
979484257_979484259 -2 Left 979484257 4:121252843-121252865 CCAGCCAGCACAATGACTGATTG No data
Right 979484259 4:121252864-121252886 TGACAGAAGTGTGCTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979484257 Original CRISPR CAATCAGTCATTGTGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr