ID: 979484259

View in Genome Browser
Species Human (GRCh38)
Location 4:121252864-121252886
Sequence TGACAGAAGTGTGCTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979484256_979484259 -1 Left 979484256 4:121252842-121252864 CCCAGCCAGCACAATGACTGATT No data
Right 979484259 4:121252864-121252886 TGACAGAAGTGTGCTGTCTTTGG No data
979484257_979484259 -2 Left 979484257 4:121252843-121252865 CCAGCCAGCACAATGACTGATTG No data
Right 979484259 4:121252864-121252886 TGACAGAAGTGTGCTGTCTTTGG No data
979484258_979484259 -6 Left 979484258 4:121252847-121252869 CCAGCACAATGACTGATTGACAG No data
Right 979484259 4:121252864-121252886 TGACAGAAGTGTGCTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979484259 Original CRISPR TGACAGAAGTGTGCTGTCTT TGG Intergenic
No off target data available for this crispr