ID: 979484260

View in Genome Browser
Species Human (GRCh38)
Location 4:121252865-121252887
Sequence GACAGAAGTGTGCTGTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979484256_979484260 0 Left 979484256 4:121252842-121252864 CCCAGCCAGCACAATGACTGATT No data
Right 979484260 4:121252865-121252887 GACAGAAGTGTGCTGTCTTTGGG No data
979484257_979484260 -1 Left 979484257 4:121252843-121252865 CCAGCCAGCACAATGACTGATTG No data
Right 979484260 4:121252865-121252887 GACAGAAGTGTGCTGTCTTTGGG No data
979484258_979484260 -5 Left 979484258 4:121252847-121252869 CCAGCACAATGACTGATTGACAG No data
Right 979484260 4:121252865-121252887 GACAGAAGTGTGCTGTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979484260 Original CRISPR GACAGAAGTGTGCTGTCTTT GGG Intergenic
No off target data available for this crispr