ID: 979484506

View in Genome Browser
Species Human (GRCh38)
Location 4:121255198-121255220
Sequence TTGTCCCTCTAGAAGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979484505_979484506 -1 Left 979484505 4:121255176-121255198 CCTTATGTAATGAATGTCAGAAT No data
Right 979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG No data
979484503_979484506 20 Left 979484503 4:121255155-121255177 CCAGCAGGACCTTCTGAGGAGCC No data
Right 979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG No data
979484504_979484506 11 Left 979484504 4:121255164-121255186 CCTTCTGAGGAGCCTTATGTAAT No data
Right 979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG No data
979484501_979484506 24 Left 979484501 4:121255151-121255173 CCATCCAGCAGGACCTTCTGAGG No data
Right 979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979484506 Original CRISPR TTGTCCCTCTAGAAGATCCA AGG Intergenic
No off target data available for this crispr