ID: 979492002

View in Genome Browser
Species Human (GRCh38)
Location 4:121338878-121338900
Sequence GAGGAGGGGAGTTATTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492002_979492011 27 Left 979492002 4:121338878-121338900 CCTTTTAAATAACTCCCCTCCTC 0: 1
1: 1
2: 1
3: 29
4: 234
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492002 Original CRISPR GAGGAGGGGAGTTATTTAAA AGG (reversed) Intronic
903346824 1:22690526-22690548 GCAGAGAGGAGTTGTTTAAAGGG + Intergenic
904023724 1:27489204-27489226 AAGGAGGAGAGTTGTCTAAAGGG - Intronic
904292043 1:29493005-29493027 GAAATGGGGAGTTATTTAATAGG - Intergenic
904481756 1:30798241-30798263 GAGGTGGGGAGAGAGTTAAATGG + Intergenic
904875422 1:33651170-33651192 GATGAGGGCAGTAATTTAGATGG + Intronic
905429200 1:37909386-37909408 GAGGAGGGGAGGTAATAGAAGGG - Intronic
906551663 1:46670790-46670812 AAAGAGGGGAGTCATTAAAATGG + Intronic
907907861 1:58800650-58800672 GAGGAGGGGATGTAGATAAATGG + Intergenic
909868842 1:80712262-80712284 GAGGAAAGGAGTTAGATAAAAGG + Intergenic
910023383 1:82620629-82620651 GAGGAGGGGAGATAATAAAATGG - Intergenic
912036081 1:105316915-105316937 GAGTAGGGAAGTTATATTAATGG - Intergenic
912146539 1:106800665-106800687 CAGAAGGAGAGGTATTTAAATGG - Intergenic
912605255 1:110982981-110983003 GAGTGTGGGAGTTGTTTAAAGGG + Intergenic
914252796 1:145935540-145935562 GAGTAGGGGAGATGTTTAGAGGG + Exonic
915785021 1:158601119-158601141 GAGGAGGGCAGCTATTATAAAGG - Intergenic
920790346 1:209084072-209084094 CAGGAGGTGAGATTTTTAAAAGG - Intergenic
920931867 1:210396178-210396200 GAAGAGGGGAAGTGTTTAAAAGG - Intronic
921087490 1:211809345-211809367 AATGAAAGGAGTTATTTAAAAGG - Intronic
922368368 1:224886810-224886832 GAGGAAGGGAGTTAATAGAAGGG - Intergenic
922387318 1:225099894-225099916 GAAGAGGGGAGGAATTTAGAGGG - Intronic
924393229 1:243586725-243586747 GAGGAGGGGAGGGGTTAAAAAGG + Intronic
924514914 1:244757892-244757914 GAGGAGGGGGGTCATTTAATAGG - Intergenic
1064263194 10:13802813-13802835 GAGGAGAGGAGCTCTTCAAATGG + Intronic
1064969669 10:21052021-21052043 GAGGAGAGGAGATATTCACATGG + Intronic
1065100944 10:22333195-22333217 GAGGAGCCGAGTTCTTTACAAGG + Intergenic
1065891385 10:30124076-30124098 TAGGAGGCAAGTTATTAAAAAGG - Intergenic
1066546596 10:36506682-36506704 CAGGAGGGGAGAAATTTTAAAGG + Intergenic
1067716078 10:48692010-48692032 GAGGAGGGTAGCAATTAAAAGGG + Intronic
1067932853 10:50580763-50580785 GAGAAGGGGAGTTGTTTAATGGG + Intronic
1069107879 10:64405790-64405812 GAGGAGGGCATTTGTGTAAATGG + Intergenic
1071281255 10:84106119-84106141 GAGGTCAGGAGTTATATAAAGGG + Intergenic
1071931985 10:90482743-90482765 AAGGAAGAGAGTTCTTTAAATGG + Intergenic
1073346899 10:102790085-102790107 GAGGAGAGGAAATATTTAAAGGG - Intronic
1074815629 10:117139566-117139588 GAGGAAAGGGGTTTTTTAAAGGG + Intergenic
1074986838 10:118666716-118666738 GAGGAGGGGTGTCATTTACAGGG - Intergenic
1075228881 10:120654643-120654665 GAGAAGGGGAGTTGTTTAATGGG + Intergenic
1076596746 10:131627463-131627485 GGGGAGGAGAGTGATATAAAGGG - Intergenic
1076620458 10:131784082-131784104 GAGCAGAGGGTTTATTTAAAGGG - Intergenic
1077543916 11:3160654-3160676 GGGGAGGGTTGTCATTTAAAGGG - Intronic
1079350732 11:19689636-19689658 GAGGAGGGGAGTCTTAAAAAAGG + Intronic
1080603215 11:33841315-33841337 GAGAAGGTGGGTTATTTGAATGG - Intergenic
1081093216 11:38898941-38898963 GTGGAGGTAAGTTATTTATAAGG - Intergenic
1081686338 11:45045884-45045906 GAGGAGGGAAGTTATTCAGTGGG - Intergenic
1083534338 11:63454625-63454647 GAGGAGGGGAGGTGATAAAAAGG - Intergenic
1085164994 11:74390958-74390980 GAAATGGGGAGTTATTTAATGGG + Intronic
1086088053 11:82976459-82976481 GATGTGGGGAGTTATATAGAAGG - Exonic
1087685088 11:101253424-101253446 GTGGGGAGGAGTTAGTTAAAGGG + Intergenic
1088058728 11:105618144-105618166 GAGGAGGGGAGTTGTGCTAAGGG + Intronic
1088215307 11:107501376-107501398 AAGGAGGGGACTGATTGAAAGGG + Intergenic
1089070208 11:115693918-115693940 GAGGAGGGGAGTTATTTAATGGG - Intergenic
1089809165 11:121117549-121117571 GGGGAGGGGAATGGTTTAAAGGG - Intronic
1091285054 11:134403944-134403966 GAGAATGGGAGTCATTTAACGGG + Intronic
1093512444 12:19945294-19945316 TAGGTGGGGCTTTATTTAAAAGG - Intergenic
1093824778 12:23670594-23670616 GAGGAATGGAGCTATATAAATGG + Intronic
1096472064 12:51885299-51885321 GAGAAGGGGAGTTATGAACAGGG + Intergenic
1096581991 12:52591642-52591664 GGGGAGGGGAGCTAGTTAAGGGG + Intronic
1096778194 12:53976438-53976460 GAGGAGAGGGGTTAATAAAAGGG - Exonic
1096790258 12:54039989-54040011 GAAGAGGGGTGGTATTTAAATGG - Intronic
1097657623 12:62387746-62387768 GAGAAGGGGAGATAATTAGAGGG + Intronic
1098071079 12:66675501-66675523 GAGAAGGGGAGATATTTTCATGG - Intronic
1100597489 12:96084254-96084276 AAGGAGGGGATTTGTTTAAGGGG + Intergenic
1103358364 12:120338749-120338771 GAGAAGGAGAGTTGTTTAATGGG - Intergenic
1107105686 13:36639902-36639924 GAAGTGGGGAGATATTTAACAGG + Intergenic
1108202624 13:48058107-48058129 GAGGAGGGGAGGTGATAAAAAGG - Intronic
1108503332 13:51087545-51087567 GATGAGGGGTGTCATTTAAAGGG - Intergenic
1110341470 13:74396737-74396759 GAGGAGGGTATTTAGTGAAAAGG - Intergenic
1111900287 13:94191677-94191699 GAGGATTGGATTTATATAAATGG - Intronic
1112394369 13:99014991-99015013 GCGGGGGGGAGAAATTTAAAGGG - Intronic
1112873438 13:104004249-104004271 CAGGAGGGTAGCTATTTTAAGGG + Intergenic
1114460456 14:22883180-22883202 GGGGGGGGGTGGTATTTAAAGGG + Exonic
1115554351 14:34532571-34532593 GAGGAGGGGAGGTATTGAGTTGG + Intronic
1116018055 14:39431016-39431038 GAGGAGGAGTGTTTGTTAAAGGG - Intronic
1116367397 14:44084401-44084423 AAGGAGGGAACTTATTTACATGG + Intergenic
1122428327 14:101624331-101624353 CTGGAGAGGAGATATTTAAATGG - Intergenic
1122805743 14:104255712-104255734 GAAGAGGGTTGTTATTTAATGGG - Intergenic
1124400505 15:29343778-29343800 GAGTAGGTGAGATATTTACACGG - Intronic
1125456049 15:39859816-39859838 GAAAAGGGGAGTTGTTTAATGGG + Intronic
1126411305 15:48375633-48375655 GAGGAAGGGAGTTCTTGATAGGG - Intergenic
1127559134 15:60118403-60118425 GAGGAGGAGAGATGCTTAAAGGG + Intergenic
1130921644 15:88351026-88351048 GAGGTGAGGTGTTATTTAGATGG - Intergenic
1133762945 16:8814287-8814309 GAGGATGGGAGTAACTGAAAAGG - Intronic
1134033196 16:11009095-11009117 GGGGTGGGGAGTTATTAAATGGG - Intronic
1136091172 16:27921101-27921123 GAGCAGGGGAGTGATATAACTGG - Intronic
1137980990 16:53069411-53069433 GGGAAGGGGAGTTGTTTAATGGG - Intronic
1139166783 16:64575638-64575660 GAGGTAGGGAGTAATTTAGAAGG + Intergenic
1139430292 16:66907515-66907537 GAGAAGGGGAGTCACTTAGATGG - Intergenic
1140533186 16:75684364-75684386 GTGGAGGGAAGGTGTTTAAATGG + Intronic
1143766194 17:9139046-9139068 GAGGAGGGGATTTAGCTAAAAGG + Intronic
1143997990 17:11024831-11024853 GAGGAGTTGAATTATTTAGATGG + Intergenic
1145080746 17:19892436-19892458 GAGGAGGGGAGGTAATAGAAGGG + Intergenic
1146268775 17:31470876-31470898 GAGGAGGGGAGTCATTATAGAGG + Intronic
1147629876 17:41923215-41923237 GAGGAGGGAGGTGATTCAAATGG - Intronic
1149242961 17:54671975-54671997 GAAGAGGTATGTTATTTAAAGGG + Intergenic
1149558556 17:57591780-57591802 GAAATGGGGAGTTATTTAACGGG + Intronic
1149963863 17:61141968-61141990 GAGGATAAGATTTATTTAAATGG + Intronic
1152385625 17:79972660-79972682 GAGATGGGGAGTTGTTTAACGGG + Intronic
1154299390 18:13179861-13179883 GAGTAGGGGAGGTAGGTAAAGGG + Intergenic
1155060788 18:22226718-22226740 GCAGAGGAGAGGTATTTAAAGGG - Intergenic
1155565804 18:27132846-27132868 AAGGAGCAGAGTTATATAAAGGG - Intronic
1157688115 18:49659195-49659217 GGGTAGGGAAGTTATTTAAAAGG - Intergenic
1158962691 18:62599641-62599663 GAGATGGGGAGTTGTTTAATGGG - Intergenic
1159077695 18:63700219-63700241 GGTGAGGGGAGTTATTTATTAGG - Intronic
1160310982 18:77789906-77789928 GAGAAAGGGAGTGATTAAAATGG + Intergenic
1161628139 19:5338722-5338744 GGGGAGGGGACTTATGCAAATGG + Intronic
1162103076 19:8352432-8352454 GAGGAGGGAAGTTGTTTAAGAGG - Intronic
1162286541 19:9743196-9743218 GAGGAGGGGAGGTAATAGAAGGG - Intergenic
1162744452 19:12790912-12790934 GAGGAGGGGAGAGATCAAAAGGG - Intronic
1162780064 19:13002293-13002315 GAGGAGGAGAGATATTCAGACGG - Intronic
1165474602 19:36023322-36023344 GACGAGGGGAGTTATGGGAAGGG - Intronic
1167566606 19:50261213-50261235 GGGGAGGGGAGTTATAGGAAGGG - Intronic
926036606 2:9640755-9640777 GAGGAGATGACTTATTTAAATGG + Intergenic
926357775 2:12057037-12057059 GAGGTGGGTAGCCATTTAAAAGG - Intergenic
926589292 2:14722606-14722628 AAGGAGGTGATGTATTTAAAAGG + Intergenic
927502911 2:23594097-23594119 GAGGAGGGGATTTAATGACAGGG + Intronic
929301376 2:40307390-40307412 GAAAAGGGGAGTTGTTTAATGGG + Intronic
930370492 2:50495069-50495091 GAGGAGGGGAGTTAGGAAACTGG - Intronic
931296141 2:60927910-60927932 GAGAAGCCCAGTTATTTAAAAGG - Exonic
933618770 2:84512395-84512417 GAGTAGGGTAGTTATTGAGAAGG - Intergenic
933786703 2:85848699-85848721 GAAAAGGGGAGTTGTTTAATAGG + Intronic
933810270 2:86028723-86028745 AAGGAAGGGATTTATTTAGAGGG + Intronic
934032981 2:88065022-88065044 GAGGAGAGGAAATATTAAAAAGG - Intergenic
934205605 2:89927021-89927043 GAAGAGGGAAGTTGTCTAAAAGG - Intergenic
935368312 2:102318121-102318143 GAAGAGAGGAGTAATTTGAAAGG + Intronic
936968676 2:118152652-118152674 AAGGATGGGAGTTATTTCAAGGG + Intergenic
937927670 2:127179635-127179657 GAGGAGGGGAGTTAGAAACAAGG + Intergenic
939996311 2:148923725-148923747 GAGGACAGGATGTATTTAAATGG - Intronic
940143907 2:150524680-150524702 AAGGAGGAGACATATTTAAAGGG - Intronic
940713249 2:157187657-157187679 GAGGAGGGGAGTTAAATAAGGGG - Intergenic
941296219 2:163741499-163741521 CAGGAGGGAAGTTATTGCAATGG + Intergenic
942097011 2:172543456-172543478 GAGGAGGGGAGGTGATAAAAAGG - Intergenic
943450056 2:188034948-188034970 GAGGAGGGGAGGTGATAAAAGGG - Intergenic
945190098 2:207179215-207179237 CAGGAGGGCAGTTTTTAAAAGGG - Intergenic
945240156 2:207669186-207669208 GAAGTGGGGAGTTGTTTAATGGG - Intergenic
946551515 2:220806711-220806733 GAGGAGGGGTGTTAGTGAATAGG - Intergenic
947063438 2:226192666-226192688 GAGAAAGAGAGTTATTAAAATGG - Intergenic
947647814 2:231757231-231757253 CAGGAGGGGACATGTTTAAAAGG - Intronic
1169539799 20:6586996-6587018 AAGAAGGGGAATTACTTAAAAGG - Intergenic
1170149980 20:13219557-13219579 GAGGAGGGGAGATGTTTGGAGGG - Intergenic
1170305639 20:14934849-14934871 GAGGAGGAGATTTATGTAGAGGG + Intronic
1171524507 20:25798629-25798651 GAGCAGTGGCGTTATTGAAAGGG - Intronic
1171552320 20:26057254-26057276 GAGCAGTGGCGTTATTGAAAGGG + Intergenic
1173273656 20:41559308-41559330 GAGGAGGAGAGCTATACAAAGGG - Intronic
1180233387 21:46441787-46441809 GAGGAGGGGAGATCTTTTGAAGG + Intronic
1180303622 22:11055958-11055980 GAGGAGGGGAGTTGTGCACAGGG + Intergenic
1180733983 22:18001885-18001907 GAAGAGAGGATGTATTTAAAGGG + Intronic
1180944384 22:19682392-19682414 GCTGAAGGAAGTTATTTAAATGG + Intergenic
1184210726 22:43034107-43034129 GAGGAGGGGAGTTGTGCACAGGG - Intergenic
949823408 3:8139343-8139365 AAGGAGGGTATTTATTTACAGGG + Intergenic
950092080 3:10303040-10303062 GGGGAAGGGAGTTATTTAATGGG + Intronic
951250732 3:20391515-20391537 CAGGAGTGGGTTTATTTAAAAGG + Intergenic
951590844 3:24262706-24262728 GAAGAGAGGTGTAATTTAAATGG - Intronic
951731832 3:25818200-25818222 GAGGAAGGGATTTAGATAAATGG - Intergenic
951925227 3:27901952-27901974 GAGGAGGGGATTCATATATAAGG + Intergenic
956506123 3:69942182-69942204 GAAAAGGGGAGTTGTTTAATGGG + Intronic
958755403 3:98245353-98245375 GAGGAGGGGAGGTAATAGAAGGG - Intergenic
958914494 3:100033627-100033649 TAGGACGGGAGCTTTTTAAATGG + Intronic
963804363 3:149708446-149708468 GAGATGGGGAGTTGTTTAATGGG - Intronic
966576532 3:181509292-181509314 GAGGAGGAGAGTTACTCAAGAGG + Intergenic
968263006 3:197340155-197340177 GAGTATGGGAGTGATTAAAAGGG - Intergenic
968310043 3:197675587-197675609 GAGGAGGGGAGTGGTCTACAGGG + Intronic
970449237 4:16150665-16150687 GAAGAGGGATCTTATTTAAAGGG - Intergenic
970532649 4:16999398-16999420 GAGGAGGGGAGGTGATAAAAGGG - Intergenic
971597390 4:28548641-28548663 GAGGAGGGGACTGATATAAATGG - Intergenic
972270617 4:37508278-37508300 GGGGAGAAGAGTTATTCAAAGGG - Intronic
973330575 4:48906986-48907008 GAGGAAGGGAGTCATTTGGAAGG - Intergenic
973608483 4:52611045-52611067 GAGAAAGGGAGTGATTTCAAGGG - Intronic
974869979 4:67629564-67629586 GAAGGAGGGAGATATTTAAATGG + Intronic
976273370 4:83251991-83252013 GAGGAGGGGAATAACTAAAAGGG + Intergenic
977352278 4:95903814-95903836 GGGGAGGAGAGTTCTTTAATGGG + Intergenic
978607520 4:110497859-110497881 GAGGAGGGTACTTAGTTGAAAGG - Intronic
978976482 4:114881201-114881223 GAGGTGGGGAGTCATTTAGAAGG + Intronic
979492002 4:121338878-121338900 GAGGAGGGGAGTTATTTAAAAGG - Intronic
979630296 4:122893878-122893900 GAGGAAGGCAGCTTTTTAAAGGG - Exonic
979755482 4:124335026-124335048 GGGGAGGGGAGGTATTACAAAGG - Intergenic
979948026 4:126859233-126859255 GAAAAGGGGAGTTATTTAATGGG + Intergenic
981252419 4:142619535-142619557 GAGTCAGGGAGTTATATAAAAGG + Intronic
981681778 4:147407824-147407846 GAGGTGGGGAGGCATTTGAAAGG - Intergenic
981940540 4:150277618-150277640 GCAGAGGGAATTTATTTAAATGG - Intronic
982739400 4:159042215-159042237 GAGGAGAGGAGACATTTGAAAGG - Intergenic
983524476 4:168746803-168746825 GAAGAGGGAAGTTATCAAAAGGG + Intronic
985193274 4:187400956-187400978 GAGGAGGTAAGTTATAAAAAAGG - Intergenic
986423098 5:7603608-7603630 GAGGAAGGGTGTTCTTTAGACGG + Intronic
986749979 5:10778449-10778471 CAAGTGGGCAGTTATTTAAATGG - Intergenic
987264502 5:16238009-16238031 TAAGAGGGAAGTTGTTTAAATGG - Intergenic
988615877 5:32774399-32774421 GAGGAGGGGACTTGTCCAAAAGG + Intronic
990257399 5:53985168-53985190 GAGGAGGGGAGTGGTGGAAAAGG - Intronic
990565199 5:57020987-57021009 GAGGAGGGGAGGTAATAGAAGGG + Intergenic
990718221 5:58662789-58662811 TAGGAGGGGATTGATTTCAAAGG + Intronic
993986984 5:94609149-94609171 AAAGAAGAGAGTTATTTAAATGG - Intronic
996597293 5:125219930-125219952 GAAGAGGGGAGTTGTTCAATGGG + Intergenic
996645284 5:125807524-125807546 TAGGTGAGGAGTTATATAAATGG - Intergenic
997157155 5:131573207-131573229 GAGGAGGGGAGGTAATGGAAGGG - Intronic
998639822 5:143996934-143996956 AATGAGGTGAGTTATATAAAGGG + Intergenic
998712223 5:144840044-144840066 GAAAAGGGGAGATATATAAAAGG - Intergenic
999440980 5:151600592-151600614 GAGGAACGGCGTGATTTAAATGG - Intergenic
999767852 5:154755016-154755038 GAGGAGGGGAGGTATCTTAAAGG - Intronic
1003347339 6:5282733-5282755 GAGAAGATAAGTTATTTAAAAGG + Intronic
1003584896 6:7379646-7379668 GAGGAGGAAAGTTAGATAAAAGG - Intronic
1003962609 6:11222888-11222910 GAGTAGGGCAGTTATTTTTAAGG + Intronic
1004299433 6:14443960-14443982 GAGAAGGGGAGCTTTTTAAAGGG - Intergenic
1004921252 6:20378169-20378191 GAGGAGGTGCGTTCTTTAATGGG + Intergenic
1004946783 6:20623636-20623658 TTGGAGGGTAGTTATTTAATAGG + Intronic
1006210328 6:32388006-32388028 GAGGAGGGGAGGCGTTTGAAGGG + Intergenic
1007254687 6:40520565-40520587 GAGGATGGGAGTTATAGGAAAGG - Intronic
1007993101 6:46277739-46277761 GGGGAAGGGAGTGCTTTAAAGGG + Intronic
1008321224 6:50116606-50116628 GAGGAGGTGAGGAATTAAAAAGG - Intergenic
1010047066 6:71457783-71457805 GAGGAAGGGATTTATTATAAGGG + Intergenic
1010049200 6:71483409-71483431 GAGAAGGGAATATATTTAAAGGG - Intergenic
1012331880 6:98001156-98001178 GAGAAAGGGAGGTATATAAATGG - Intergenic
1012762660 6:103321457-103321479 GAGAATGGCCGTTATTTAAAAGG - Intergenic
1014386008 6:120803462-120803484 GAGGAGGAGAGTTCTGTGAAAGG - Intergenic
1015042626 6:128740359-128740381 GAGAAGGGGAGTTTATCAAAGGG + Intergenic
1015209137 6:130676596-130676618 GAAGAGTAGAGCTATTTAAAAGG - Intergenic
1015378865 6:132544079-132544101 GAAGGGAGGAGTTATTTAAATGG + Intergenic
1015634197 6:135260129-135260151 GAGGAGGGGAGAGATTAAAAGGG + Intergenic
1015723629 6:136274654-136274676 GGGGAGGGGATTAATTTTAAAGG + Intronic
1016010278 6:139132405-139132427 GATGAAGGTAGTTAATTAAAGGG - Intergenic
1016248788 6:142017547-142017569 GAGGAGGGGAGGTGATAAAAAGG - Intergenic
1020899457 7:13987312-13987334 GAGAGAGGGAGGTATTTAAATGG + Intronic
1021278547 7:18687287-18687309 GAGTAGAAGATTTATTTAAATGG - Intronic
1021802907 7:24325655-24325677 GAGGAGGACAATTATTCAAAAGG + Intergenic
1024675603 7:51635623-51635645 GAGGAGGGGATTGCCTTAAAGGG - Intergenic
1024909438 7:54428419-54428441 GAGAAAGAGAGTTATCTAAATGG + Intergenic
1025097443 7:56107297-56107319 GCGGGGGGGAGTCATTTGAACGG + Intergenic
1030441767 7:109596025-109596047 GAGGAGGGGAGGTGATAAAAAGG + Intergenic
1032211068 7:129914476-129914498 CTGGAGGGGAGTTGTTTAAAAGG - Intronic
1032754857 7:134879860-134879882 GATGTAGGGAGTTATTAAAATGG - Intronic
1033625505 7:143106555-143106577 GAGGAGGGGAGGTAATAGAAGGG - Intergenic
1035404778 7:158589735-158589757 GAGGAGGAGAGTTAGGGAAAGGG - Intergenic
1037220291 8:16511111-16511133 GAGGGTGGGAGATTTTTAAAAGG - Intronic
1037463982 8:19141043-19141065 GAAGAGGGGAGTTCTTTAAAGGG - Intergenic
1038223969 8:25637570-25637592 GAGGAGAGGCAATATTTAAAGGG - Intergenic
1038297194 8:26305057-26305079 GAAGAAGGGAGTTATTTAACGGG - Intronic
1039533086 8:38282289-38282311 GAGGAGGGGTGTGATTGTAAAGG - Intronic
1041774215 8:61506331-61506353 GGGAATGGGAGTTATTTAATGGG + Intronic
1042796889 8:72673797-72673819 GAAATGGGGAGTTATTTTAAGGG + Intronic
1044288775 8:90442650-90442672 GAGCAGGGGAGTTCATTAAAAGG - Intergenic
1044351855 8:91175828-91175850 GAGCAGGGGAGTGATATAATTGG + Intronic
1045371402 8:101527508-101527530 CAGGAGAAGAGTTGTTTAAAAGG - Intronic
1045905341 8:107338170-107338192 GAGTAGGGGATGTATTTGAAGGG + Intronic
1046239646 8:111474542-111474564 GAGAATGTGAGTTATTTAAAAGG - Intergenic
1046772192 8:118127222-118127244 GAAGAGGGCATTTATTTTAAGGG - Intergenic
1050932026 9:11341063-11341085 AATGAGGGGAGTTTTTAAAAGGG - Intergenic
1051323886 9:15943247-15943269 GAAGAGCAGAGATATTTAAAAGG + Intronic
1054861215 9:69955768-69955790 GAGGAGGAGAACTATTCAAAGGG - Intergenic
1055094455 9:72397220-72397242 GAAGAAAGGAGTTATTTAAAGGG + Intergenic
1056770006 9:89471212-89471234 GGGCTGGGGAGTTATTTAATGGG + Intronic
1056891666 9:90499961-90499983 GAGGAAATGAGTTATTTATAGGG - Intergenic
1060678317 9:125537477-125537499 GGGAGGGGGAGTTATTTTAAAGG - Intronic
1061450695 9:130665598-130665620 GCGGAGGGGACTTGTTTAAAAGG - Intronic
1186224394 X:7382241-7382263 GAGTTGGGGAGATATTTTAAGGG - Intergenic
1186705149 X:12133125-12133147 GAGCAGTGGAGTTCATTAAAAGG + Intergenic
1186843325 X:13506799-13506821 GAAGAGGGGATTTTTTTAACAGG + Intergenic
1187366882 X:18673235-18673257 GAAAAGGGGAGTTGTTTAATAGG + Intergenic
1187876809 X:23810827-23810849 GAAATGGGGAGTTATTTAATAGG + Intergenic
1187984549 X:24796203-24796225 AAGGAGGGGAGCTATTGCAAAGG + Intronic
1188212103 X:27439201-27439223 AAGGAGGGCATTTATTTACAAGG + Intergenic
1189142373 X:38620278-38620300 GAGGAGGCGAATTCTTTACAGGG - Intronic
1190320043 X:49174738-49174760 GTGGGGAGGAGTTATTTCAATGG - Exonic
1192172898 X:68867813-68867835 GAGGAGGGGAGTTTTTCAGATGG - Intergenic
1196409086 X:115396902-115396924 GAGGAGGGTATTTCTTTCAAAGG + Intergenic
1197299326 X:124758885-124758907 GAAGAGGGAAGTTGTTTAATGGG + Intronic
1198969101 X:142260767-142260789 GATGTGGGGAGTTTTTTAATGGG - Intergenic
1199151563 X:144492788-144492810 GTGGAGGGGAGAAACTTAAAAGG + Intergenic
1199255224 X:145711884-145711906 GAAGAGGGGGGTTATTTACTCGG - Intergenic
1200770593 Y:7121469-7121491 CAGGATGGGAGTTATATAAGGGG - Intergenic