ID: 979492003

View in Genome Browser
Species Human (GRCh38)
Location 4:121338892-121338914
Sequence GAAAGGATTACATGGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492003_979492011 13 Left 979492003 4:121338892-121338914 CCCCTCCTCCATGTAATCCTTTC 0: 1
1: 0
2: 1
3: 25
4: 307
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492003_979492015 27 Left 979492003 4:121338892-121338914 CCCCTCCTCCATGTAATCCTTTC 0: 1
1: 0
2: 1
3: 25
4: 307
Right 979492015 4:121338942-121338964 GTTTTCAGGAGTTCTGATGTTGG 0: 1
1: 0
2: 2
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492003 Original CRISPR GAAAGGATTACATGGAGGAG GGG (reversed) Intronic
901978628 1:13015571-13015593 AAAATGATAACATGGGGGAGAGG - Intronic
902003454 1:13213367-13213389 AAAATGATAACATGGGGGAGAGG + Intergenic
902022682 1:13359119-13359141 AAAATGATAACATGGGGGAGAGG + Intergenic
902241632 1:15094059-15094081 GAAGAGAATACATGGAGGGGAGG + Intronic
903851875 1:26312157-26312179 GAGATGATTTCATGGGGGAGGGG - Intronic
904015716 1:27418759-27418781 GAAAGGAGTGCATGGGGGTGTGG + Intronic
905338487 1:37261733-37261755 CAAAGGAGAACAAGGAGGAGTGG - Intergenic
906120308 1:43385571-43385593 GAAAAGAATACATGTAGGACTGG + Intronic
906146752 1:43565090-43565112 GAAAGCTTTCCAGGGAGGAGGGG - Intronic
907109074 1:51909974-51909996 GAAAGGATTAAATGGAGAATGGG - Exonic
908460009 1:64340012-64340034 TAAAGGATTTCAAGTAGGAGAGG - Intergenic
909353891 1:74685076-74685098 GAAAGGATTCTATGCAGAAGAGG + Intergenic
911730632 1:101288924-101288946 GAAAGGATTAAATGTTTGAGGGG + Intergenic
911747211 1:101453107-101453129 GAAAGAATTTGACGGAGGAGCGG - Intergenic
915147557 1:153804038-153804060 GAAAGGAAAACTTGGGGGAGGGG + Intergenic
918161330 1:181903170-181903192 GGAAGTAATTCATGGAGGAGAGG + Intergenic
921242835 1:213204112-213204134 GAAAGTTTAGCATGGAGGAGAGG - Intronic
922279897 1:224114024-224114046 GGAAGGGGTACCTGGAGGAGTGG - Intergenic
922688293 1:227665152-227665174 GAAAGAATTACAAGAAGGGGTGG + Intronic
923374212 1:233343937-233343959 GAAGGGATTAGCTAGAGGAGAGG + Intronic
923990239 1:239427793-239427815 AAAAGGATTAGATGAGGGAGTGG + Intronic
1063040781 10:2335212-2335234 GACAAGATTAAATGAAGGAGTGG - Intergenic
1064037088 10:11923247-11923269 GCAAGGATGACATGCAGGTGGGG + Intronic
1065976044 10:30843165-30843187 GAAAGGAGTACAGTGAGGAATGG - Intronic
1067397938 10:45941361-45941383 GATAGGAGTACAGGAAGGAGAGG - Intergenic
1067866256 10:49910454-49910476 GATAGGAGTACAGGAAGGAGAGG - Intronic
1068598422 10:58929608-58929630 GAGAGGATGACATAGAAGAGTGG - Intergenic
1070289523 10:75105336-75105358 GAAAGCATAAAATGGAAGAGGGG - Intronic
1070336974 10:75464476-75464498 GAAAGGATGAGATGGAGGAAGGG + Intronic
1071075630 10:81748176-81748198 GAAAAGATTAGATGTGGGAGAGG - Intergenic
1071146034 10:82573505-82573527 GAGAGGTTTAAATGGAGAAGGGG - Intronic
1071978031 10:90975110-90975132 TAAAGGATTCCATGGAAGAAGGG + Intergenic
1072081271 10:92034577-92034599 AAAAGTATTACTTGGAGTAGAGG + Intergenic
1072525596 10:96268723-96268745 GAAGGAATTACTAGGAGGAGAGG - Intronic
1073988239 10:109233822-109233844 GATCCGATTACATGGAGAAGTGG - Intergenic
1074051628 10:109886063-109886085 GAAAGAATTACAGGGAGCTGGGG - Intronic
1074596290 10:114870808-114870830 CAAAGCAGTACATAGAGGAGTGG - Intronic
1077433709 11:2528256-2528278 GAAAGGGCTTCCTGGAGGAGGGG + Intronic
1080129053 11:28771385-28771407 GAAAGCATCACATGGTGGAGGGG - Intergenic
1080347268 11:31338972-31338994 GAAAAGTTTACATTGAGGATGGG - Intronic
1080417897 11:32086681-32086703 GAAAGGATTAGAAGGAACAGTGG - Intronic
1080695516 11:34600255-34600277 GAAAGGAAAAGATGAAGGAGAGG + Intergenic
1082708770 11:56527316-56527338 GAAAGAAATACATGGGGGTGTGG + Intergenic
1082718331 11:56642235-56642257 GAAAGAAATACATGGGGGTGTGG + Exonic
1082852334 11:57776471-57776493 GAAAGAATTACAGGGAGGCGAGG - Intronic
1085280199 11:75325084-75325106 GAAAGGACTACATGGTGCAGGGG + Intronic
1086841618 11:91692432-91692454 GCAAGGATTGGATGGAGAAGTGG - Intergenic
1086960084 11:92972524-92972546 GAAAGGCAGACAGGGAGGAGTGG + Intronic
1087571875 11:99938116-99938138 TAAAGGATTTGATGGAGGAAAGG + Intronic
1087800600 11:102499182-102499204 CAAAGGACTGCATGGAGCAGGGG - Intergenic
1088228936 11:107653608-107653630 GAAAGGAGGAGAGGGAGGAGAGG - Intronic
1090030776 11:123204310-123204332 AGAAGGATTACATGGCTGAGAGG - Intergenic
1090402806 11:126459751-126459773 GGAAGTATTACATGGAGGAGAGG + Intronic
1091513838 12:1157734-1157756 GAAAGGGTTTCAAAGAGGAGAGG + Intronic
1091525092 12:1291991-1292013 GAAAGGATAAAAGGGAGCAGGGG + Intronic
1091882202 12:3989073-3989095 GAGATGATGACATGGAGGATTGG + Intergenic
1093091739 12:14929139-14929161 GAAAAGAGTACAGGGAGGGGGGG - Intronic
1094059891 12:26302374-26302396 GAAAGTATTGCATAGACGAGGGG + Intergenic
1094415837 12:30214022-30214044 GGAAGGAAAACATGGGGGAGGGG + Intergenic
1094651596 12:32383853-32383875 GAAAAGATTACAAGTAGAAGAGG - Intergenic
1095790823 12:46165293-46165315 GTAAGGATTAAAAGGATGAGAGG + Intergenic
1096031478 12:48419662-48419684 GCAAGGGAGACATGGAGGAGAGG + Intergenic
1096460088 12:51817562-51817584 GAAATGAATGCATGGAGGAAGGG - Intergenic
1096507868 12:52107495-52107517 GGAAGAAGTACATGGAGGTGTGG - Intergenic
1097109532 12:56647975-56647997 GAAATCATTCCATGGTGGAGTGG + Intergenic
1097899917 12:64862401-64862423 GAAAGGAAGACATGAAGTAGAGG + Intronic
1098050334 12:66446288-66446310 GAGAGAAAGACATGGAGGAGTGG - Intronic
1098101928 12:67027124-67027146 GAAAGGAGAGCAGGGAGGAGGGG + Intergenic
1100626009 12:96333290-96333312 GATAGAATTATATGTAGGAGGGG - Intronic
1101371546 12:104136273-104136295 GAAACAATTAAATGGGGGAGGGG + Intronic
1101958717 12:109232249-109232271 GGAGGGATTACAGGGAGCAGAGG + Intronic
1103274589 12:119701071-119701093 GAAAGGAATAAGAGGAGGAGAGG + Intronic
1103421563 12:120788935-120788957 GAAAGGATGACATGGAAAACAGG - Intronic
1105584705 13:21733251-21733273 GAGAGGATTATAGGGAGCAGTGG - Intergenic
1107152766 13:37131221-37131243 GAGAGGATTAGATGAAGGTGAGG - Intergenic
1107409536 13:40145593-40145615 GAATGGACTAAATGGAGTAGAGG - Intergenic
1107597417 13:41977302-41977324 GAAGGGATTAGATGGATAAGCGG - Intergenic
1107716505 13:43204850-43204872 GAAAGAAATAGAGGGAGGAGAGG + Intergenic
1108601843 13:52001569-52001591 GCAAAGATTTCATGGAGGTGAGG - Intronic
1108693259 13:52879281-52879303 GAAAGGATTTCTTGAAGGAATGG - Intergenic
1114401183 14:22412299-22412321 GAAAGCATTTCAAGGAGGAATGG - Intergenic
1115701514 14:35958010-35958032 GAAACAACTTCATGGAGGAGAGG + Intergenic
1116863750 14:50014984-50015006 GAAAGGAAGACAGGGAGGAAGGG + Intergenic
1116959086 14:50951910-50951932 GAGAAGATGACATGGAGGTGTGG + Intergenic
1117405393 14:55397218-55397240 GAAAGGAGTGCATGTGGGAGAGG - Intronic
1118504184 14:66392479-66392501 GAAAGGAAGAGAGGGAGGAGGGG - Intergenic
1118695590 14:68381884-68381906 GACAGGGTTCCATGCAGGAGAGG - Intronic
1118818054 14:69326578-69326600 GGAAGGCTTCCATGGAGGAATGG + Intronic
1119247583 14:73126031-73126053 CAAAGAATTACTTGGGGGAGAGG - Intergenic
1119762386 14:77160843-77160865 GAAAGGACTCCATGCGGGAGGGG - Intronic
1120373032 14:83662931-83662953 TAAAGGATTATCTGGAGGAAGGG - Intergenic
1121445187 14:93974154-93974176 GAAAGATTTAAATGGAGGCGGGG - Intronic
1121843533 14:97154298-97154320 GAAAGGAATAATGGGAGGAGAGG - Intergenic
1122729938 14:103788958-103788980 GAGAGTATTGCAGGGAGGAGAGG + Intronic
1123976137 15:25556106-25556128 GAGAGGAGGACCTGGAGGAGTGG + Intergenic
1125604752 15:40933626-40933648 GAAAAGGCTTCATGGAGGAGGGG - Intronic
1126038665 15:44570351-44570373 GAAATGATAACTTGGAGCAGAGG + Intronic
1126370166 15:47937823-47937845 GAAAGGACGAGATGGAGGAAGGG + Intergenic
1127655536 15:61051897-61051919 GAAAGGCAGAAATGGAGGAGGGG - Intronic
1128734024 15:70042009-70042031 GACAGAATTACAAGGAGGAATGG - Intergenic
1128945248 15:71815310-71815332 GAAATGATTACAAGGAGAAAAGG + Intronic
1130248944 15:82282974-82282996 GAAAATATAACCTGGAGGAGAGG - Exonic
1130415281 15:83688080-83688102 GAAAGGAATGGATGGAGAAGGGG + Intronic
1132534952 16:473993-474015 CAAAGCAAGACATGGAGGAGAGG - Intronic
1133973745 16:10585350-10585372 GAAAGGATAACAGGAAGCAGGGG + Intergenic
1134650483 16:15904616-15904638 GAATGGAGACCATGGAGGAGTGG - Intergenic
1135491891 16:22916450-22916472 GCAAGGACTACATGGGGCAGAGG + Intergenic
1135846088 16:25919861-25919883 TAAAGAATGAAATGGAGGAGAGG + Intronic
1137747064 16:50830227-50830249 GAGAGGAATACATACAGGAGAGG + Intergenic
1138535149 16:57656026-57656048 GAAAGGGTGACATGGCCGAGGGG - Intronic
1138611215 16:58126298-58126320 GGAAGGATGAGATGGAGGGGAGG + Intronic
1141672617 16:85500643-85500665 GGAAGGGTGACATGGAGAAGAGG - Intergenic
1143251800 17:5528336-5528358 GAAAGGAAGAGATTGAGGAGAGG - Intronic
1143617556 17:8062691-8062713 AAAAGTATTACTTGGGGGAGGGG + Intergenic
1143765816 17:9137119-9137141 GAGAGGTCTTCATGGAGGAGGGG - Intronic
1143816601 17:9521171-9521193 GACTGGATTACACGGAAGAGAGG + Intronic
1144163599 17:12585509-12585531 GAAAGGGAAACATGGAGGACAGG + Intergenic
1144319322 17:14098845-14098867 CAAAGAATCACATGGAGCAGAGG - Intronic
1147570764 17:41569374-41569396 GATAGGAATAGATGGAGGGGAGG + Intronic
1148673718 17:49432675-49432697 GAAATGAATACATAGAGTAGGGG - Intronic
1151859428 17:76748799-76748821 GGAAAGAATACAGGGAGGAGGGG - Intronic
1153297697 18:3563377-3563399 GAGAGGAATACAAGAAGGAGAGG - Intronic
1153597326 18:6740968-6740990 GCAAGGAAAACATGGAAGAGGGG + Intronic
1153600570 18:6777312-6777334 AAAAGGATTACAGTTAGGAGGGG + Intronic
1154103235 18:11496450-11496472 GAAAGACTTGGATGGAGGAGGGG - Intergenic
1156490480 18:37493042-37493064 GCAGGGAGTACTTGGAGGAGTGG - Intronic
1158012408 18:52744055-52744077 GAAGGAATTTCATGGAGGATAGG + Intronic
1158096781 18:53781501-53781523 CAAGGTATTTCATGGAGGAGTGG + Intergenic
1159007822 18:63028537-63028559 AAAAGGATGACATAGATGAGTGG - Intergenic
1159912761 18:74162007-74162029 GAAGGGAGGCCATGGAGGAGAGG + Intergenic
1159999045 18:74998444-74998466 GAAAGCATTATATGGAAAAGTGG - Intronic
1160267853 18:77355929-77355951 GAAAGGTTTACTTGGGAGAGAGG + Intergenic
1161213328 19:3079779-3079801 GAAAGGGAGACAGGGAGGAGGGG + Intergenic
1161416784 19:4151726-4151748 GAGAGGAAGACAGGGAGGAGGGG - Intergenic
1161801526 19:6418977-6418999 GCAAGGATGACAGGGAAGAGGGG + Intronic
1161941355 19:7406495-7406517 GAAAAGATTATATGGAGTATAGG - Intronic
1161942689 19:7415494-7415516 GAAAGGTTTATGTGGAGGATTGG - Intronic
1163073319 19:14864529-14864551 GAAAGAAGTACATGGGGGTGTGG + Intergenic
1163079505 19:14927276-14927298 GAAAGAAGTACATGGAGGTGTGG - Intergenic
1163578235 19:18123030-18123052 GAGAGGACTTCCTGGAGGAGAGG + Intronic
1164719188 19:30419832-30419854 GAAAGGATGCCGTGGAGCAGAGG - Intronic
1165284361 19:34827944-34827966 GAAGGGATTACATGGAGCACAGG + Intergenic
1166226879 19:41401478-41401500 GATTGGATTAGAAGGAGGAGTGG + Intronic
1166518520 19:43464250-43464272 GAAAGGACTATAAGGAGGCGGGG + Intronic
1166688813 19:44810887-44810909 GAAAGGATCTCAGGGAGGAGGGG + Intronic
1167024945 19:46908897-46908919 GCAGGGATTGCATGGAGGTGGGG + Intergenic
1167463589 19:49638880-49638902 GAAAGCATGGGATGGAGGAGGGG + Intronic
1168347716 19:55659075-55659097 GAAGGGATTCAATGGAGGAAGGG - Intronic
925897933 2:8487641-8487663 GAAAGGATTCCTTAGGGGAGGGG + Intergenic
926849655 2:17181124-17181146 GAAAGGATTCCATGTGGGAATGG - Intergenic
926893273 2:17657439-17657461 GGCAGGATAACAGGGAGGAGAGG + Intergenic
927457632 2:23270396-23270418 GCTACAATTACATGGAGGAGAGG + Intergenic
928098710 2:28422369-28422391 GAGACAATTCCATGGAGGAGAGG + Intergenic
928737725 2:34311406-34311428 GAAAGGAGAAGATGGAGGAAAGG + Intergenic
929858961 2:45659202-45659224 GAAGGGCTTAGATTGAGGAGAGG - Intronic
931617085 2:64170484-64170506 GAAAGGATTGGGTTGAGGAGTGG - Intergenic
931748381 2:65310094-65310116 GAGAGGAGGACTTGGAGGAGTGG - Intergenic
932004241 2:67912114-67912136 GTAAGGATTTCATGGATGGGAGG - Intergenic
932422263 2:71608218-71608240 GACAGGATTAGAGAGAGGAGAGG + Intronic
933614740 2:84471993-84472015 GAAAGAATTATATGGGGAAGAGG - Intergenic
933996057 2:87670881-87670903 GAAAGGATGACATGAGGGTGAGG + Intergenic
936297798 2:111280031-111280053 GAAAGGATGACATGAGGGTGAGG - Intergenic
938783043 2:134602747-134602769 GAGAGCATTTCAAGGAGGAGAGG - Intronic
939279597 2:140045116-140045138 GAAAGAATCTCATGGAGAAGAGG - Intergenic
939799536 2:146691723-146691745 AAAAGGATTACATGAAGCACAGG + Intergenic
939800027 2:146697127-146697149 GAAAGCTCTACATGGTGGAGAGG + Intergenic
940386699 2:153082298-153082320 GAAAGGATGAGAGGGAGGTGAGG - Intergenic
941741323 2:169038591-169038613 GAAAGGATTCCAGGAAGTAGAGG - Intergenic
942135336 2:172919596-172919618 GAAAGGATGCCATGGAAGAGGGG - Intronic
942296720 2:174524628-174524650 AAAAAGTGTACATGGAGGAGGGG - Intergenic
942496837 2:176548913-176548935 GAAAGTATTTCACGTAGGAGGGG - Intergenic
943464077 2:188207181-188207203 GAAGGGATTACAGGCATGAGCGG - Intergenic
943852128 2:192737467-192737489 GAAAAGGTTAAATGGAGGAAGGG - Intergenic
945486340 2:210400949-210400971 GAAGGGACAACATAGAGGAGTGG + Intergenic
946169831 2:217888296-217888318 GAATGGAGCAGATGGAGGAGAGG - Intronic
947188300 2:227473243-227473265 GAAAGGATTAATTGCGGGAGGGG + Intronic
948533178 2:238626519-238626541 GAAAGGAGAACAAGGAGGGGTGG - Intergenic
1168798807 20:630678-630700 GAAAAGGTTCCATTGAGGAGAGG - Intergenic
1168953466 20:1818162-1818184 GAGAGGCTGACATGGAGGGGTGG - Intergenic
1169898136 20:10526000-10526022 GAGAGGACTCCATGGAGAAGTGG - Intronic
1170461358 20:16579617-16579639 GAAAGAACTCGATGGAGGAGAGG - Intergenic
1172371209 20:34393582-34393604 GAAAGTAAAACATGGAGGAGGGG + Intronic
1172379445 20:34475837-34475859 AAAATGAGTACATGGATGAGTGG - Intronic
1174674220 20:52337725-52337747 GAAAGCACTGAATGGAGGAGTGG + Intergenic
1175426707 20:58871969-58871991 GACAGGAGTACGGGGAGGAGAGG + Intronic
1175774274 20:61643189-61643211 GAAAGCATCACAGGGAGGGGGGG + Intronic
1176271726 20:64238927-64238949 GAAAGGGTTGCATGGGGGATAGG - Intronic
1177946240 21:27472744-27472766 GAGAGGATCACATGGAGCATAGG + Intergenic
1181288402 22:21771748-21771770 GTGAGGATTACATGGGTGAGAGG - Intronic
1181322975 22:22022816-22022838 GACAGGATCACAAGGAGGGGAGG - Intergenic
1182100782 22:27655988-27656010 GAAAGGATGGAATGGAGGAAGGG + Intergenic
1183505429 22:38206017-38206039 GACAGGAGGGCATGGAGGAGTGG + Intronic
1185137520 22:49081166-49081188 GAAAGGATGGCAGGGAGGAGAGG + Intergenic
950139411 3:10604887-10604909 GAAAGCTGTACATGGAGGAGGGG - Intronic
950465789 3:13153053-13153075 GAAAGGAGTAGATAGGGGAGGGG - Intergenic
951368196 3:21811746-21811768 GAAAGTAATTCATGGAGAAGAGG + Intronic
951865834 3:27306260-27306282 CAAAGGATTACAAGGATGGGAGG - Intronic
952434663 3:33260853-33260875 GAAAGGATGAGAGGGAGGTGAGG - Intergenic
952614851 3:35258415-35258437 GTAAGCAGTACATGAAGGAGAGG + Intergenic
953722413 3:45368186-45368208 TAAAAGATTACATCTAGGAGAGG + Intergenic
954578904 3:51692416-51692438 GAAAGGACTTCACTGAGGAGTGG + Intronic
959130792 3:102353708-102353730 AAAAGGATTACGTGGAGGGAAGG + Intronic
961179252 3:124863491-124863513 GAAAGGAACACATGGAATAGAGG - Intronic
961345361 3:126260376-126260398 GAAAGGAGGACAGGGAGGAGGGG - Intergenic
962252987 3:133849660-133849682 GAAGGGATTTCAGGAAGGAGAGG - Intronic
963909943 3:150808269-150808291 GGAAGGATGAAATGGAGGAGAGG - Intergenic
963932778 3:151021509-151021531 TAAAGGAACAGATGGAGGAGAGG - Intergenic
964213347 3:154252277-154252299 GAGAGGATTACATGGAATAGTGG + Intronic
964419904 3:156490752-156490774 GAACAGATAAAATGGAGGAGGGG + Intronic
964930920 3:162021364-162021386 GAAATGTTTACATGAAAGAGTGG - Intergenic
965775777 3:172229507-172229529 AAAAGGGTCACATTGAGGAGGGG - Intronic
965916043 3:173847111-173847133 TAAAGGAATACATTTAGGAGAGG - Intronic
966073728 3:175909747-175909769 GAAAGAATTGCTTGGTGGAGAGG + Intergenic
966135835 3:176697252-176697274 GAAAGAACTACATGTGGGAGAGG + Intergenic
966596282 3:181726898-181726920 GAAAGGACGGGATGGAGGAGGGG + Intergenic
968154228 3:196366017-196366039 TAAAGCATTACATGGAAGAAAGG + Intronic
968530134 4:1087016-1087038 GAGAGGATGGCATGGGGGAGAGG + Intronic
968740726 4:2330531-2330553 GAAGGGACAGCATGGAGGAGGGG + Intronic
970482887 4:16495618-16495640 GAAAGGATTTCCTGCAGGACTGG + Intergenic
970644317 4:18102594-18102616 GGAAGGATTCCATGGAAGTGGGG + Intergenic
972197512 4:36672057-36672079 GAAAGGATTTCATCAAGGATAGG - Intergenic
973774206 4:54230452-54230474 GAAATGATTCCACCGAGGAGGGG - Intronic
974106583 4:57476574-57476596 GGAAGAATTAAATGGAGAAGAGG + Intergenic
974226518 4:59052466-59052488 TTAAGGATTACATGGAGTATGGG - Intergenic
975567687 4:75776406-75776428 GAAAAGATTAAATGGAAGAGGGG + Intronic
975594954 4:76041370-76041392 GAAAGGATTCAAAAGAGGAGAGG - Intronic
975975055 4:80085868-80085890 GAAATAGTTATATGGAGGAGAGG - Intronic
976626120 4:87184610-87184632 GAAAGGAAAAAATGGAGGAAGGG + Intronic
977211845 4:94227249-94227271 TAAAGGATGAGATGAAGGAGGGG + Intronic
978703501 4:111676510-111676532 GAAAAGATAACATGAAAGAGTGG - Intergenic
979492003 4:121338892-121338914 GAAAGGATTACATGGAGGAGGGG - Intronic
980455409 4:133034298-133034320 GAAAGGGTAGCACGGAGGAGTGG + Intergenic
980747600 4:137039677-137039699 GAAAAGGTTAAATAGAGGAGTGG - Intergenic
983161950 4:164427630-164427652 AAAAGGAATACAAGGAGGAAAGG + Intergenic
983818294 4:172160045-172160067 GAAATGATTTACTGGAGGAGGGG + Intronic
984757486 4:183337770-183337792 GCTTGGATTACATGGAAGAGTGG - Intergenic
985005381 4:185529916-185529938 GGAAAGATTACCTGCAGGAGAGG - Intronic
985338895 4:188926538-188926560 GAAAGGATGACTTAGAAGAGGGG + Intergenic
987442805 5:17977766-17977788 GAAAAGATTACTTGGATGAAGGG - Intergenic
987487427 5:18540032-18540054 AAAAAGATTACAGGGTGGAGGGG - Intergenic
987498205 5:18672844-18672866 AAAAAGATTACAGGGTGGAGGGG + Intergenic
987705078 5:21452737-21452759 GACAAGGTTACAAGGAGGAGAGG - Intergenic
989135887 5:38154315-38154337 AAAAGGGTTCCATGGAGGTGTGG + Intergenic
990010873 5:50995745-50995767 GAAAGCATTCAAGGGAGGAGTGG - Intergenic
990017931 5:51088971-51088993 GAAAAGATGCCATGGAGGAGGGG - Intergenic
991456600 5:66810734-66810756 GAAAGAATTGCAGAGAGGAGTGG - Intronic
992206227 5:74433045-74433067 CAAAGAATAGCATGGAGGAGTGG + Intergenic
992732064 5:79681613-79681635 GAAAGCATTATATCGAAGAGAGG - Intronic
992948585 5:81833987-81834009 GCAGAGATGACATGGAGGAGAGG - Intergenic
993037838 5:82776675-82776697 GGAAGTATTGCATGGAGGAATGG + Intergenic
993737740 5:91498083-91498105 GAAAGTATAAGATGGAAGAGTGG + Intergenic
994130962 5:96226799-96226821 GAAATGATTCCAGGGAGGAGCGG - Intergenic
995914869 5:117232910-117232932 GAAAGGATAGCAAGGAGGACTGG + Intergenic
996135471 5:119836656-119836678 GAAAAGATTAGATGGAGCATAGG - Intergenic
997026248 5:130065507-130065529 GAAAGGGTCACATAGAGGATGGG - Intronic
998355748 5:141534883-141534905 GGAAGGATAACATGGTGGAAGGG - Intronic
999035256 5:148341797-148341819 GAGAGGATAACAAGGAAGAGTGG - Intergenic
999120257 5:149204271-149204293 GAGAGGAACATATGGAGGAGTGG + Intronic
1000296781 5:159919141-159919163 GAAAAGATGACATGGAGAAAAGG - Intronic
1001129832 5:169054681-169054703 TAAAGGATTCCCTGTAGGAGAGG - Intronic
1004066803 6:12254342-12254364 GAAAGGTTTACAAGGAGAAGTGG - Intergenic
1006775939 6:36592650-36592672 GAAAAGCTTACATAGAGGAGGGG + Intergenic
1006883467 6:37359641-37359663 GATAGCATTTCTTGGAGGAGGGG + Intronic
1007073594 6:39053267-39053289 GGGAGGATGAAATGGAGGAGTGG + Intronic
1007823848 6:44583198-44583220 GAAAAGATAAGATGGAGAAGAGG - Intergenic
1009558822 6:65211715-65211737 GAAAGGAATATCTGTAGGAGGGG + Intronic
1010181312 6:73089550-73089572 GAAAGGATGGGAAGGAGGAGAGG - Intronic
1011259961 6:85460681-85460703 GAAAAGAGTAAATGGAGAAGTGG - Intronic
1017611889 6:156195568-156195590 GAAAAAATGATATGGAGGAGAGG - Intergenic
1018268712 6:162053556-162053578 GAAAGGATTACAAAGAACAGAGG + Intronic
1018432888 6:163736906-163736928 GGAAGGATGGCATGGAGGTGTGG + Intergenic
1019002368 6:168764932-168764954 GAAAGCATCACATGGAAGAAGGG - Intergenic
1021644186 7:22771832-22771854 AAAAGGAAGACATGGAGTAGAGG + Intergenic
1021967820 7:25939140-25939162 GAAAGGAAGAGATGTAGGAGAGG + Intergenic
1022225950 7:28363495-28363517 GGAAAGACTACATGGAAGAGAGG - Intronic
1022265400 7:28748834-28748856 GAAAGGAATAAATGCAAGAGGGG + Intronic
1023536307 7:41215986-41216008 GAAAGAATTTGGTGGAGGAGTGG - Intergenic
1024824266 7:53371241-53371263 GAAACACTCACATGGAGGAGGGG + Intergenic
1026223086 7:68417361-68417383 TAAAGGTTTACGTGGTGGAGTGG - Intergenic
1026371460 7:69704030-69704052 AAAAGGATGACAGAGAGGAGAGG - Intronic
1027170979 7:75872284-75872306 GAAGGGCTTACTGGGAGGAGAGG - Intronic
1027602729 7:80259351-80259373 GAAAGGATTCCTTTGAGCAGTGG + Intergenic
1027712982 7:81631367-81631389 TAAAGGCTTACATGGAAGTGAGG - Intergenic
1028115618 7:86993936-86993958 GAAAAGATTCAATTGAGGAGAGG - Intronic
1028317372 7:89420219-89420241 GAAAGCCTTACATGAAGAAGAGG - Intergenic
1031349309 7:120709566-120709588 GAAATGACGACATAGAGGAGAGG - Intronic
1032690388 7:134280623-134280645 GAAAGTATGACAAGGAAGAGAGG - Intergenic
1033611138 7:142964044-142964066 CAATGGATTGAATGGAGGAGGGG + Intergenic
1034403254 7:150880542-150880564 GTAAGGAGTACGTGGAGGGGAGG + Intergenic
1036040583 8:5075905-5075927 GAAAGGATTATCTGGTGGATAGG + Intergenic
1037256237 8:16958124-16958146 GAAAAGGCCACATGGAGGAGAGG + Intergenic
1037282229 8:17254654-17254676 GAAAGGATTACATGTAAGAAAGG - Intronic
1038156740 8:24998609-24998631 GAAAGAGTTGCATGGAGAAGTGG - Intergenic
1039857758 8:41431108-41431130 AAAAGGATTACATGGGGTTGGGG + Intergenic
1040026386 8:42786166-42786188 GAAAGGAGGAAAAGGAGGAGAGG + Intronic
1042058846 8:64795377-64795399 GAAAGGGTTTGATGGAGAAGAGG - Intronic
1043078184 8:75729031-75729053 GATAAGATTACTTGGAGGACTGG - Intergenic
1043724026 8:83586417-83586439 TATAGGATAAAATGGAGGAGAGG - Intergenic
1044865736 8:96569342-96569364 GAAGGCATTTCATGGAGGAAAGG - Intronic
1045233944 8:100333181-100333203 GAAAGCATCACATGGACAAGAGG - Intronic
1047457380 8:125028379-125028401 GACAGGAGTACATGGTGGAGAGG + Intronic
1047773025 8:128045789-128045811 GAAAGGAAAACATGGCAGAGAGG - Intergenic
1047807076 8:128371817-128371839 GACAGAATTAAATGGATGAGAGG + Intergenic
1048988640 8:139748693-139748715 GGAAGGCTTCCAGGGAGGAGAGG - Intronic
1051542123 9:18231426-18231448 CAAAAGATTCCAAGGAGGAGGGG - Intergenic
1051857816 9:21589411-21589433 GAACGGAAGCCATGGAGGAGGGG + Intergenic
1051947442 9:22587242-22587264 GAAAAGATTCAAAGGAGGAGGGG - Intergenic
1052866742 9:33468696-33468718 GAGAGGATTCCCAGGAGGAGTGG + Intronic
1053588572 9:39486755-39486777 AAAACAATTACATGGAGGAAGGG + Intergenic
1054577733 9:66878539-66878561 AAAACAATTACATGGAGGAAGGG - Intronic
1055604414 9:77953450-77953472 TACAAAATTACATGGAGGAGAGG + Intronic
1056031648 9:82559853-82559875 GAAAGGAAGAAATGGAGGAGGGG + Intergenic
1056233704 9:84571329-84571351 GAGAGGATCACATGGAAGGGTGG + Intergenic
1056337243 9:85584618-85584640 CAAAGGATTACATGTAAGAATGG - Intronic
1057072356 9:92110314-92110336 GAAAGAATTTTATGGAGAAGAGG - Intronic
1057581841 9:96294060-96294082 GAAAAGCCTACATGAAGGAGAGG + Intronic
1058896907 9:109408368-109408390 AAAATGTTTACAGGGAGGAGTGG - Exonic
1059202193 9:112428609-112428631 GAGTGGATTGCATGGAGGAAGGG + Intronic
1059828393 9:118060732-118060754 GGAAGGATTAAATGTAGCAGTGG + Intergenic
1059971283 9:119671242-119671264 GGAAGGGTTGCATGGAGGAGTGG + Intergenic
1060774928 9:126366070-126366092 GAAAGGAAGACACAGAGGAGGGG - Intronic
1061135824 9:128732761-128732783 CAAAAGTTCACATGGAGGAGGGG - Intronic
1185477699 X:425213-425235 GAAAGGTTTGGATGGAGGTGGGG + Intergenic
1185921293 X:4096059-4096081 GAAAGGATAACATGGGGAACTGG + Intergenic
1186647925 X:11526896-11526918 GAGAGGTTAAAATGGAGGAGAGG + Intronic
1189668114 X:43379112-43379134 GAAAGAATGAGAGGGAGGAGAGG + Intergenic
1193430709 X:81400687-81400709 GAAATGATCACATGGAGAATAGG + Intergenic
1195858384 X:109355233-109355255 GAAAGGAGTGCTTGGAAGAGTGG + Intergenic
1196701015 X:118668837-118668859 GAAGGGATTAAAGGGAGGAGGGG + Intronic
1198343715 X:135739711-135739733 TAAAGGCTAACATGGAGCAGAGG - Intergenic
1199599820 X:149535281-149535303 GAAAGGAGGACCAGGAGGAGAGG - Intergenic
1199620840 X:149699303-149699325 GCAAAGATTGCTTGGAGGAGGGG + Intronic
1199650822 X:149944971-149944993 GAAAGGAGGACCAGGAGGAGAGG + Intergenic
1199907755 X:152251765-152251787 GGAAGGAATAGATGGAAGAGAGG - Intronic