ID: 979492004

View in Genome Browser
Species Human (GRCh38)
Location 4:121338893-121338915
Sequence GGAAAGGATTACATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 374}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492004_979492011 12 Left 979492004 4:121338893-121338915 CCCTCCTCCATGTAATCCTTTCC 0: 1
1: 0
2: 3
3: 30
4: 374
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492004_979492015 26 Left 979492004 4:121338893-121338915 CCCTCCTCCATGTAATCCTTTCC 0: 1
1: 0
2: 3
3: 30
4: 374
Right 979492015 4:121338942-121338964 GTTTTCAGGAGTTCTGATGTTGG 0: 1
1: 0
2: 2
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492004 Original CRISPR GGAAAGGATTACATGGAGGA GGG (reversed) Intronic
901362099 1:8710470-8710492 GGAAAGTAAAACATGAAGGAAGG - Intronic
903328326 1:22584008-22584030 GGAAAGGAATAAATGAGGGAGGG + Intronic
904132942 1:28288808-28288830 GGAAAGGATTTGAAGCAGGAAGG + Intergenic
904152498 1:28453913-28453935 GGAAAAGAATACATGGAACACGG + Intronic
905294733 1:36947061-36947083 GGAAAAGAGGACATGGGGGAAGG + Intronic
905415200 1:37799271-37799293 TGAATGGATTATATGGAGGCAGG + Intronic
906331787 1:44891351-44891373 AGGAAGGATTACTTGGAGGTAGG - Intronic
907109075 1:51909975-51909997 TGAAAGGATTAAATGGAGAATGG - Exonic
908468850 1:64422326-64422348 GGAAAGAAATAAATGGAAGAAGG - Intergenic
909597363 1:77421725-77421747 GGGAGGGATCACATGGAGGCAGG - Intronic
910041713 1:82860296-82860318 GCAAAGGAACACATGGATGATGG + Intergenic
910175330 1:84424136-84424158 GGAAAGGATTTCTAGAAGGAAGG + Intergenic
913709846 1:121472288-121472310 GGGAAGTCTTACATGGAGGCAGG + Intergenic
916360440 1:163961868-163961890 ATCAAGGATTACATGAAGGAAGG + Intergenic
916500623 1:165383931-165383953 GGAAAGCATTTCCTGGTGGATGG - Intergenic
916528263 1:165631569-165631591 GGAAAGGAAGGAATGGAGGAAGG - Intronic
918632336 1:186732582-186732604 GGAAAAGATTCCATTGAAGAAGG + Intergenic
920018043 1:202929194-202929216 GGAAGGTATGACATGGAAGATGG - Intergenic
920543549 1:206797299-206797321 GGAAGGGAATTCATGGCGGAGGG + Intergenic
920562550 1:206948997-206949019 GCAAAGGCTTGCAGGGAGGAAGG + Intergenic
920678756 1:208057073-208057095 GGAAAGGGTTATATTGAGGAAGG + Intronic
921085406 1:211786616-211786638 GGTATGGATTTGATGGAGGAAGG - Intronic
921199961 1:212794777-212794799 GGAAAGCATTTCAAGAAGGAAGG + Intronic
922318293 1:224462080-224462102 GGGAGGGTTTACATGGAGCAGGG - Intronic
922887066 1:229028322-229028344 GGAAAGGATGAAAGGAAGGAAGG + Intergenic
923386223 1:233467392-233467414 GGAAGGGATTCCATCAAGGAGGG + Intergenic
923950256 1:238943477-238943499 GTTAAAGATTAAATGGAGGAAGG - Intergenic
1065530520 10:26665481-26665503 GTAAAGGATTGCATGTAGAAAGG + Intergenic
1066462182 10:35621747-35621769 GAAGAGGCTTACATGGATGATGG - Intergenic
1069241119 10:66140286-66140308 GGAAAGAATTGAAAGGAGGAGGG - Intronic
1070289524 10:75105337-75105359 GGAAAGCATAAAATGGAAGAGGG - Intronic
1070336973 10:75464475-75464497 GGAAAGGATGAGATGGAGGAAGG + Intronic
1070694025 10:78548537-78548559 GGAAAGGAAAAAATGAAGGATGG + Intergenic
1071146035 10:82573506-82573528 GGAGAGGTTTAAATGGAGAAGGG - Intronic
1071978030 10:90975109-90975131 ATAAAGGATTCCATGGAAGAAGG + Intergenic
1073599124 10:104829774-104829796 GGAAAGCATTTCAAGGAAGAGGG - Intronic
1074476055 10:113775473-113775495 GGAAATGATTCCATAGAAGAAGG - Intronic
1075170811 10:120112067-120112089 GGAATGGTTTACAGAGAGGAAGG - Intergenic
1075598161 10:123747468-123747490 GGAAAGGACTACATGGACTGAGG + Intronic
1076102956 10:127797571-127797593 GGAAAGTATGAGATGGAGGGAGG - Intergenic
1076102991 10:127797697-127797719 GGAAAGTATGAGATGGAGGGAGG - Intergenic
1076765307 10:132630033-132630055 GGAAAGGTGTTCATGGAGGAGGG + Intronic
1078339179 11:10486807-10486829 GGAAAGGAGGAGATGAAGGAGGG + Intronic
1078457450 11:11486234-11486256 GGAAATGAATACAGGGAAGAAGG - Intronic
1078687578 11:13547427-13547449 GGCAAGTCTTACATGGAGGCAGG - Intergenic
1079663537 11:23073564-23073586 GGAATAGATTAGATTGAGGAGGG - Intergenic
1079942332 11:26697107-26697129 GGAAAGGATAACAAGGATGATGG - Intronic
1080129054 11:28771386-28771408 GGAAAGCATCACATGGTGGAGGG - Intergenic
1080347269 11:31338973-31338995 AGAAAAGTTTACATTGAGGATGG - Intronic
1081331985 11:41813515-41813537 GGAAAATATTACATTGAGCATGG + Intergenic
1082039416 11:47672696-47672718 GGAAGGGATGACATGGTGAATGG + Intronic
1083313957 11:61802723-61802745 GGAAATGATGACATGTAGGGTGG - Intronic
1083796791 11:65021593-65021615 GGATGGGATGACATGGAGCAGGG + Intronic
1085280198 11:75325083-75325105 AGAAAGGACTACATGGTGCAGGG + Intronic
1085356215 11:75839976-75839998 GGAAAGGAGGACAAGGAGGTAGG - Intronic
1085607660 11:77916986-77917008 GGAAAACATAACTTGGAGGATGG + Intronic
1086824170 11:91475229-91475251 GGGAATGGTTGCATGGAGGATGG + Intergenic
1087251481 11:95905051-95905073 GGAAAGTGTTTCAAGGAGGAAGG - Intronic
1087505020 11:99009884-99009906 GGAAAGAATTTCAAGAAGGAAGG - Intergenic
1087815891 11:102658536-102658558 GGAAAGGAAAAGAGGGAGGACGG - Intergenic
1088552052 11:111023123-111023145 GGGAAGGATAACTTGGAGGTAGG + Intergenic
1090010181 11:123039149-123039171 GGCAAGGATTACATGAAAGAAGG + Intergenic
1090420524 11:126572225-126572247 GGAAGGGAATACTTGGAGGCAGG - Intronic
1091175397 11:133553277-133553299 GGAAATGATGGCATGGTGGAAGG - Intergenic
1091750961 12:3020958-3020980 GGAAAGGAAGCCAGGGAGGAGGG - Intronic
1092061890 12:5557843-5557865 GGAAAGCATTTCCTGGAGCAAGG - Intronic
1093091740 12:14929140-14929162 GGAAAAGAGTACAGGGAGGGGGG - Intronic
1093856039 12:24103799-24103821 GGTAAGGAGTACATGCAAGATGG + Intergenic
1095367797 12:41428852-41428874 GGAGAGGATGAAATGAAGGAAGG + Intronic
1096256085 12:50063184-50063206 GGCAGGGATTCCATGGAGGGGGG + Intronic
1096460089 12:51817563-51817585 AGAAATGAATGCATGGAGGAAGG - Intergenic
1097201675 12:57284153-57284175 GGTAAGAATTAAAGGGAGGATGG + Intronic
1097502468 12:60422224-60422246 GGAAAGGATGAGATGGAAGGAGG - Intergenic
1097573575 12:61362132-61362154 GGAAAGGATGAAAAGAAGGAAGG - Intergenic
1099441094 12:82700910-82700932 GGCACGGCTTACATGGAGGCAGG + Intronic
1099509367 12:83515062-83515084 GCAAAGGTTTACAGGGATGATGG - Intergenic
1100626010 12:96333291-96333313 GGATAGAATTATATGTAGGAGGG - Intronic
1101333084 12:103772774-103772796 GGTAAGGGTTACAGGCAGGAAGG + Exonic
1101353898 12:103958453-103958475 GGAAATGAGGCCATGGAGGAGGG - Intronic
1101371545 12:104136272-104136294 GGAAACAATTAAATGGGGGAGGG + Intronic
1101668692 12:106845922-106845944 AGAAAGTATTTCAAGGAGGAGGG - Intronic
1101827309 12:108230719-108230741 GGAAGGAATTACCTAGAGGAGGG + Intronic
1103198075 12:119063405-119063427 AGAGAGGAAAACATGGAGGAGGG - Intronic
1104432824 12:128730646-128730668 GGTATTGATTACATGTAGGAAGG - Intergenic
1106122258 13:26870374-26870396 GGAAGGCATTACATGGCAGAAGG - Intergenic
1107215028 13:37906519-37906541 GGAAAGGACTAGTTGGGGGAAGG + Intergenic
1107640607 13:42439516-42439538 GGAAAGAATTTCATGGACAAAGG + Intergenic
1108980370 13:56503508-56503530 GGGAAGGCTAACATGGAGAATGG + Intergenic
1109335262 13:60986069-60986091 GAAAAGGAATGCATGGAGGGAGG - Intergenic
1109457453 13:62611358-62611380 GGGATGGAGCACATGGAGGAAGG - Intergenic
1110641703 13:77831943-77831965 GGAAAGAAGGAGATGGAGGAGGG - Intergenic
1111074949 13:83221961-83221983 TGAAATGATTAAATGGATGATGG - Intergenic
1111906208 13:94259020-94259042 GGAAAGGTTTCCAGTGAGGAAGG - Intronic
1112047704 13:95614566-95614588 GGAAAAGAGTACATGGAGAAAGG + Intronic
1113433325 13:110268881-110268903 GGAAAGGAACCCAAGGAGGAGGG + Intronic
1113598636 13:111552658-111552680 GGACAGGAATACAGGGAGGTAGG - Intergenic
1114586050 14:23814860-23814882 GCAAAGAATGACAAGGAGGAAGG + Intergenic
1116161396 14:41270368-41270390 GGTAAGGATTACTTGGAGAGTGG - Intergenic
1116863749 14:50014983-50015005 AGAAAGGAAGACAGGGAGGAAGG + Intergenic
1117628491 14:57665058-57665080 GGAAAGGAGAAGATGGAAGAGGG - Intronic
1118894137 14:69931758-69931780 GTCAAGGTTTACATGGAGAAAGG + Intronic
1119293878 14:73517728-73517750 GGAAAGGGAGACATGAAGGAAGG + Intronic
1120264293 14:82229986-82230008 GGCAATGATTTCATGGGGGAAGG - Intergenic
1120373033 14:83662932-83662954 ATAAAGGATTATCTGGAGGAAGG - Intergenic
1120588963 14:86352223-86352245 GTAAAGAATTTCATGGAGGATGG + Intergenic
1121280650 14:92694945-92694967 GGAAAGGACTTCCTGGAGGCAGG - Intergenic
1122173103 14:99893232-99893254 GAAGAAGTTTACATGGAGGAAGG + Intronic
1122474652 14:101998644-101998666 GGAAACGGTTACAGGCAGGATGG - Intronic
1122536994 14:102472257-102472279 CAAAAGGGTTACATGGAGAACGG + Intronic
1124644772 15:31430486-31430508 GGAAGGCATCACATGGTGGAAGG + Intronic
1125022842 15:35002017-35002039 GAAAAGGAATGCATGAAGGAAGG + Intergenic
1125059834 15:35406220-35406242 GGGAAGGATAACATGGAGGTAGG + Intronic
1126370165 15:47937822-47937844 AGAAAGGACGAGATGGAGGAAGG + Intergenic
1126506340 15:49407809-49407831 TGAAAGGATTACTTGGGTGATGG - Intronic
1127521144 15:59744201-59744223 AGCAAGCATTTCATGGAGGAGGG + Intergenic
1127781121 15:62317164-62317186 GGAAAGGATGTAATGGAGGTAGG + Intergenic
1128690887 15:69723996-69724018 GGACAGAATTACAAGGTGGAGGG + Intergenic
1129096315 15:73212258-73212280 GGAAAGGATGATATGGGGGATGG - Intronic
1129362012 15:75029986-75030008 GGAAAGGGTTGCCTGGAGCAGGG + Intronic
1130075138 15:80682171-80682193 GAAGTGGATCACATGGAGGAAGG + Intronic
1130415280 15:83688079-83688101 GGAAAGGAATGGATGGAGAAGGG + Intronic
1131077993 15:89510320-89510342 GGAAAGGAATTCCAGGAGGAGGG + Intergenic
1131571540 15:93542152-93542174 GGAGGGGATGAGATGGAGGAAGG + Intergenic
1131931797 15:97450623-97450645 GGATAAGAAGACATGGAGGAGGG + Intergenic
1132914154 16:2333272-2333294 GGACAGGCTTTCATGGAGGGAGG - Intronic
1133864275 16:9627153-9627175 GGAGAGGATGACACAGAGGATGG - Intergenic
1134261021 16:12650871-12650893 GGAAAGTGGCACATGGAGGAGGG + Intergenic
1136493874 16:30629343-30629365 GGAAAGGATCAGTTTGAGGACGG - Intergenic
1137088840 16:36162769-36162791 GGAAAGGAAGAGAGGGAGGAGGG + Intergenic
1137093365 16:36221996-36222018 AGAAAGGAAGACAGGGAGGAGGG + Intergenic
1137372935 16:47925643-47925665 GGAAAGGAATAGCTGGAGTATGG - Intergenic
1138535150 16:57656027-57656049 GGAAAGGGTGACATGGCCGAGGG - Intronic
1138693921 16:58793553-58793575 GGGAAGGAATCCAGGGAGGAAGG - Intergenic
1139738124 16:69010656-69010678 GGGGAAGATTTCATGGAGGAGGG - Intronic
1140408757 16:74728477-74728499 GGAAAGGATGACAGGGAGTGTGG + Intronic
1142017017 16:87754832-87754854 GGAAAGGTGTGCATGGTGGAAGG - Intronic
1145967779 17:28932561-28932583 GGAAAGGATTCCAGGGAGAAAGG + Intronic
1146231219 17:31112082-31112104 GGAATGGATTATAAGGAGGCTGG - Intronic
1147398865 17:40166872-40166894 GGAAAGGGGTAGATGGGGGAGGG + Intronic
1148458873 17:47826400-47826422 GGAAAGGCAGACATGGAGCAGGG - Intronic
1149062431 17:52438653-52438675 AGAAAGAATTTCAAGGAGGATGG - Intergenic
1149653926 17:58299973-58299995 GAAAAGTTATACATGGAGGATGG - Intergenic
1149775231 17:59351969-59351991 GGGAAGGATTCCAGGGAAGATGG + Intronic
1151326632 17:73383742-73383764 GGAGAGGCACACATGGAGGAGGG + Intronic
1151457300 17:74233644-74233666 GGAAAGGAGGACTTGGAGCAGGG - Intronic
1153543330 18:6180535-6180557 GGAAAGGATTAAATGGAAGATGG - Intronic
1153805018 18:8704125-8704147 GGTAATAATTACAAGGAGGAGGG - Intergenic
1154103236 18:11496451-11496473 GGAAAGACTTGGATGGAGGAGGG - Intergenic
1154484734 18:14864804-14864826 GGAAAGGGTGGCAAGGAGGATGG - Intergenic
1155758689 18:29536524-29536546 GGAAATGATTACTTTGAGGTAGG - Intergenic
1155828910 18:30486735-30486757 GGAAAGGATTACATGATGGCTGG + Intergenic
1156472859 18:37388406-37388428 GGAAAGGAGGAGAAGGAGGAGGG - Intronic
1156657276 18:39303632-39303654 GGAGGGCATTACATGGAGCAAGG - Intergenic
1156672676 18:39489669-39489691 GGAAAAGATTCCAAGGAGAAAGG - Intergenic
1157434479 18:47656853-47656875 GGAAAGGATTAGAGGGAAGCAGG + Intergenic
1159329897 18:66978853-66978875 GGAAAGGTTTACATAGACAATGG - Intergenic
1159522460 18:69543949-69543971 GGAAAGGATTTAATAGAGAAAGG + Intronic
1159908100 18:74116753-74116775 GGCAGGGATCACATGGAGGCAGG + Intronic
1161213327 19:3079778-3079800 GGAAAGGGAGACAGGGAGGAGGG + Intergenic
1161416785 19:4151727-4151749 GGAGAGGAAGACAGGGAGGAGGG - Intergenic
1161679659 19:5673543-5673565 TGAATGGATTAGATGAAGGATGG - Intergenic
1164931193 19:32177554-32177576 GGAAAGGAAGGCAGGGAGGAAGG + Intergenic
1165632747 19:37315680-37315702 GCAACCGATTACATGGAGAAGGG + Intronic
1166688812 19:44810886-44810908 CGAAAGGATCTCAGGGAGGAGGG + Intronic
1166945429 19:46393369-46393391 GGAAAGCATTTAATGGGGGAAGG + Intergenic
1168347717 19:55659076-55659098 GGAAGGGATTCAATGGAGGAAGG - Intronic
925657863 2:6168824-6168846 GGAAAGGACTCCAAGGAGAAAGG - Intergenic
925897932 2:8487640-8487662 GGAAAGGATTCCTTAGGGGAGGG + Intergenic
926472966 2:13284726-13284748 GAAAAGGAGTACATGGTGTATGG - Intergenic
928586951 2:32769527-32769549 GGAGACCTTTACATGGAGGAAGG + Intronic
928645965 2:33352949-33352971 AGAAAGGCTTACAAGGGGGAGGG - Intronic
928756793 2:34536230-34536252 AGAAAGGAATAAAAGGAGGAAGG - Intergenic
929356160 2:41027248-41027270 GGAAAGGATTATGGAGAGGACGG + Intergenic
929459342 2:42090667-42090689 GGCTAAGATTACAAGGAGGAAGG + Intergenic
930215580 2:48692992-48693014 GGTGAGGATTATATTGAGGATGG + Intronic
931166394 2:59753859-59753881 CGTGAGGAATACATGGAGGATGG + Intergenic
931822127 2:65962695-65962717 GCAAAGGACTACATGAAGTAAGG + Intergenic
931987453 2:67755566-67755588 GGCAAGGTGGACATGGAGGACGG + Intergenic
932207741 2:69898352-69898374 GGGAGGGATTATATAGAGGAGGG + Intronic
932209680 2:69915992-69916014 GGAAATAATTAAATGGAGTAAGG - Intronic
933213026 2:79593579-79593601 GGACAGGATGACATGGTGGGAGG - Intronic
934569313 2:95358693-95358715 GGAAAGCATCACATGGCTGAAGG + Intronic
934965143 2:98715013-98715035 AGAAAGAAATACATGAAGGAGGG + Intronic
937274639 2:120675820-120675842 GGAAAGGATGAAAGCGAGGATGG + Intergenic
937447430 2:121970852-121970874 GGAAAGGACTCCATGGATGTGGG - Intergenic
937457404 2:122054554-122054576 GGAAAGGATTTAAAGGTGGAAGG - Intergenic
937828109 2:126389645-126389667 GGCAAGGCTTACATGGTGGCAGG - Intergenic
938980121 2:136518420-136518442 GGAAAGGAAAAAAGGGAGGAAGG - Intergenic
939407636 2:141779249-141779271 GGAAAGCATTTCATGGAGACAGG - Intronic
940328408 2:152449908-152449930 GGAAAGGTTTCTATGTAGGATGG - Intronic
940769338 2:157823946-157823968 GGAAAAGATTACATGGGCCAGGG - Intronic
941408801 2:165126627-165126649 GGAAAGGAGAAGAGGGAGGAAGG - Intronic
941873520 2:170410244-170410266 GGAATGAACTACAGGGAGGAAGG + Intronic
942135337 2:172919597-172919619 GGAAAGGATGCCATGGAAGAGGG - Intronic
942184797 2:173414783-173414805 GGAAGGGACTACATGCAGAAAGG - Intergenic
942227893 2:173832562-173832584 AGAAAGCAATACATGGAGCACGG + Intergenic
942764505 2:179438861-179438883 GGAGCTAATTACATGGAGGAGGG + Intergenic
942944085 2:181654664-181654686 GTAAAAGATTAAATGGAAGAGGG - Intronic
943487234 2:188501316-188501338 GGCAAGTCTTACATGGAGGCAGG - Intronic
943852129 2:192737468-192737490 AGAAAAGGTTAAATGGAGGAAGG - Intergenic
944482325 2:200170711-200170733 GGACAGTATTTCAAGGAGGAGGG - Intergenic
944521638 2:200575914-200575936 GGAATGGATAAATTGGAGGAGGG - Intronic
944534637 2:200696831-200696853 GGAAAGGGTGACAAGAAGGAGGG + Intergenic
944586217 2:201176104-201176126 GGAAAGTATAACTTGGAAGAGGG + Exonic
944916072 2:204361713-204361735 GGAATGGATTTCATGGAGTATGG + Intergenic
944994466 2:205278049-205278071 GGATAGGATTTCAAGTAGGAAGG + Intronic
946162409 2:217843685-217843707 GTAAAGGGTTTCAAGGAGGAAGG - Intronic
946192921 2:218016850-218016872 GGAAAGGGAGACAGGGAGGAAGG + Intergenic
946369511 2:219272073-219272095 GAGAAGGATTACAAGGAGGTGGG + Intronic
947978072 2:234384857-234384879 GGAAAGGCTTTCCTGGAGGTAGG - Intergenic
948012175 2:234657615-234657637 GGAAAGGAATAAATGTAGAAAGG - Intergenic
948184371 2:236008324-236008346 GGAAAGGCTTTTTTGGAGGATGG - Intronic
948458397 2:238117856-238117878 GGAGAGGGATACATGGAGGGGGG + Intronic
1169806982 20:9569548-9569570 GGAAAGTATTTCAAGAAGGAAGG + Intronic
1169968399 20:11242584-11242606 AGAAAGGATTTCATGAAGGTAGG - Intergenic
1170135264 20:13066768-13066790 GGAAAGGAAGAGAAGGAGGAGGG - Intronic
1171051110 20:21860013-21860035 TGAAAGGATGACATGAAGAAAGG - Intergenic
1172371208 20:34393581-34393603 AGAAAGTAAAACATGGAGGAGGG + Intronic
1172697481 20:36832482-36832504 GAAAGGGATTCCATGGAGAATGG - Intronic
1172891327 20:38267801-38267823 GGACATGCTTACTTGGAGGAAGG + Intronic
1173179181 20:40789437-40789459 TGAAAGGATGCCATGGAGGCTGG + Intergenic
1173551399 20:43935282-43935304 GGAGAGGCTTACAGGGAAGATGG - Intronic
1173768245 20:45633342-45633364 GGAAATGATTACAGTTAGGAAGG + Intergenic
1174645739 20:52084147-52084169 GGAAAGGGTTAAAGTGAGGAAGG - Intronic
1174693508 20:52533483-52533505 GCACAAGATTGCATGGAGGATGG - Intergenic
1175831638 20:61967781-61967803 GGAGGGGGTTACAGGGAGGAGGG - Intronic
1176723487 21:10412157-10412179 GGAAAGGGTGGCAAGGAGGAAGG - Intergenic
1176796590 21:13374671-13374693 GGAAAGGGTGGCAAGGAGGACGG + Intergenic
1177001096 21:15614210-15614232 TGAAAGGATTACATACAGTATGG + Intergenic
1178047385 21:28710694-28710716 GGAATGAAATATATGGAGGATGG + Intergenic
1180304644 22:11064929-11064951 GGAAAGGGTGGCAAGGAGGAAGG - Intergenic
1181783768 22:25211036-25211058 AGGAAGGATTACAGGGAGGCTGG + Intergenic
1182100781 22:27655987-27656009 TGAAAGGATGGAATGGAGGAAGG + Intergenic
1182647959 22:31825764-31825786 TGAAAGGGTTACATGTGGGAAGG - Intronic
1182754575 22:32668491-32668513 GGAAAGGAGTGAAGGGAGGAGGG - Intronic
1183884994 22:40872403-40872425 GAAAATGATTCCATGTAGGAAGG + Intronic
1184022670 22:41831591-41831613 GGAAATGATGACATGGACAAAGG - Intergenic
1184312156 22:43653110-43653132 GGAAAGGAGTCCAGGGAGGGAGG + Intronic
1185376464 22:50484719-50484741 GTAAAGGCTTTCCTGGAGGAGGG - Exonic
949868978 3:8570837-8570859 TGAAAGGATAACAGGAAGGAAGG - Intergenic
950139412 3:10604888-10604910 GGAAAGCTGTACATGGAGGAGGG - Intronic
950284212 3:11732186-11732208 AGAAAGGGAGACATGGAGGAAGG - Intergenic
950346131 3:12295163-12295185 GGAAAGGATAACATTCAGTAAGG - Intronic
950647272 3:14384590-14384612 AGAAAGGCTTACATGGTGGGGGG - Intergenic
950878240 3:16298332-16298354 GCTAAGGATAACAGGGAGGATGG - Intronic
951403966 3:22271046-22271068 GGAAAAGATTTCATGGAAGGAGG - Intronic
951704442 3:25529543-25529565 GGAAATGATGAAATGGACGATGG + Intronic
951839562 3:27019864-27019886 GGAAGAGATTACATGGAAGAAGG + Intergenic
952235824 3:31479151-31479173 TCAAAGGATTATAGGGAGGATGG - Intergenic
952704461 3:36363223-36363245 GGATAGGAGTCCATGGGGGATGG + Intergenic
953759050 3:45672633-45672655 GGGAAGGATGAGATGGTGGAAGG - Intronic
957337503 3:78850607-78850629 AGAAACTGTTACATGGAGGAGGG + Intronic
957695062 3:83625472-83625494 TGAAAGGATTACAAGGCAGATGG - Intergenic
958111264 3:89149286-89149308 GGAAAGTATTACTTTGAGGATGG + Intronic
959230598 3:103646061-103646083 TGAAAGTATTACCTGGGGGATGG + Intergenic
960127905 3:114020502-114020524 GGAGAGGATGAAAGGGAGGAAGG + Intronic
960129719 3:114043073-114043095 GGACAGGAAGACATGGAAGATGG + Intronic
960694348 3:120381394-120381416 AGAAAGCATTTCAGGGAGGAAGG + Intergenic
961103418 3:124221112-124221134 GAAAAGGAGTGCATGGAGGAGGG - Intronic
961345362 3:126260377-126260399 GGAAAGGAGGACAGGGAGGAGGG - Intergenic
962283178 3:134067148-134067170 GGAAAGGATGCCAAGGAGGAGGG - Intronic
963189362 3:142452143-142452165 GTTAAGGATGACATGAAGGATGG + Intronic
964724398 3:159799400-159799422 GTAGAGGATTACAAAGAGGATGG + Intronic
966557537 3:181280248-181280270 GGAAAGGATTATAGACAGGAGGG + Intergenic
968740725 4:2330530-2330552 GGAAGGGACAGCATGGAGGAGGG + Intronic
968947900 4:3675127-3675149 AGAAAGGAAGACAGGGAGGAAGG - Intergenic
969564048 4:7967192-7967214 GGGCAGGATTGCATTGAGGATGG + Intronic
969652584 4:8476662-8476684 GGAGAGGGTCTCATGGAGGAGGG - Intronic
969875345 4:10132089-10132111 TGTATGGATTACATGGAGAAAGG - Intergenic
970974309 4:22025267-22025289 AGAAGGGATTAGAAGGAGGATGG + Intergenic
971458351 4:26866450-26866472 AGAGAGTATTACCTGGAGGAGGG + Intronic
971615648 4:28787916-28787938 GGAAAGGAGTACAGGAAGCAGGG + Intergenic
973900061 4:55460062-55460084 GGAAATGAATATATGGAAGATGG - Intronic
973915216 4:55626755-55626777 GCAAAGGACTACATGGAAAAAGG - Intronic
974226519 4:59052467-59052489 ATTAAGGATTACATGGAGTATGG - Intergenic
975567686 4:75776405-75776427 TGAAAAGATTAAATGGAAGAGGG + Intronic
976309660 4:83598251-83598273 GAAAAGCATGACATGGAGAAGGG - Intronic
976626119 4:87184609-87184631 AGAAAGGAAAAAATGGAGGAAGG + Intronic
977211844 4:94227248-94227270 GTAAAGGATGAGATGAAGGAGGG + Intronic
977545252 4:98369045-98369067 GTAAAGGCTTACATGGTGGCAGG + Intronic
977587890 4:98795091-98795113 GAAAGGGATAACCTGGAGGAGGG + Intergenic
978998568 4:115187550-115187572 GGAATGTATTACATGGTGGCAGG + Intergenic
979492004 4:121338893-121338915 GGAAAGGATTACATGGAGGAGGG - Intronic
979931048 4:126631095-126631117 GGAAAGGATTACATCGAAATAGG - Intergenic
983028619 4:162770071-162770093 GGAAAGGATCAAAGGGAGCAGGG - Intergenic
984302530 4:177940811-177940833 GGAGAGGATGGCATGGAGGATGG + Intronic
986313326 5:6570995-6571017 GGAAAGGAAGAGAGGGAGGAGGG + Intergenic
987442806 5:17977767-17977789 TGAAAAGATTACTTGGATGAAGG - Intergenic
988856739 5:35234408-35234430 AGACAGGATTAGATGAAGGAAGG - Intergenic
988888229 5:35582587-35582609 GGAAAGGAGTAATTAGAGGAAGG - Intergenic
989198531 5:38739661-38739683 GGAAAGGATTTGAAGAAGGAAGG + Intergenic
989967018 5:50476165-50476187 GGGAAGGCTTACATGGAGTGAGG - Intergenic
990017932 5:51088972-51088994 AGAAAAGATGCCATGGAGGAGGG - Intergenic
991620932 5:68544909-68544931 GGGAAGGCTGACATGGATGACGG + Intergenic
991732326 5:69601854-69601876 GGAAAAAATTACAGGGAGAAGGG + Intergenic
991808758 5:70456997-70457019 GGAAAAAATTACAGGGAGAAGGG + Intergenic
991862626 5:71025999-71026021 GGAAAAAATTACAGGGAGAAGGG - Intergenic
993220340 5:85087455-85087477 GGAAAGGATGAAATAAAGGAGGG - Intergenic
995290694 5:110448704-110448726 GGAAAGTATCAAAAGGAGGAAGG + Intronic
996284026 5:121767882-121767904 GGAAGGGGTTGCAGGGAGGAAGG - Intergenic
997026249 5:130065508-130065530 AGAAAGGGTCACATAGAGGATGG - Intronic
997449301 5:133968717-133968739 AGGAAGGATTGCAGGGAGGAGGG + Exonic
998355749 5:141534884-141534906 AGGAAGGATAACATGGTGGAAGG - Intronic
998577232 5:143329193-143329215 GGAAAGTCTTACATGGTGGCAGG + Intronic
998981057 5:147702496-147702518 GGAAAGGAAGACAGGAAGGAAGG + Intronic
999153117 5:149440002-149440024 GGAAAGGAGCACAGGAAGGAAGG - Intergenic
1000462315 5:161537923-161537945 AGAAAGAATAACATAGAGGAGGG - Intronic
1001320454 5:170676216-170676238 GGAAAGGATTACAGGTGGGAGGG + Intronic
1002066101 5:176652485-176652507 CTAAAGGTTTGCATGGAGGATGG + Intronic
1002210094 5:177593639-177593661 GGCCAGGATGACCTGGAGGAAGG - Exonic
1002308046 5:178295731-178295753 GGAACTGATTAAATAGAGGATGG + Intronic
1003922608 6:10847187-10847209 GGAAGGGTTAACATGTAGGAGGG - Intronic
1004206873 6:13599269-13599291 GGAAAGGAAGAAATGGAGGGAGG - Intronic
1005137372 6:22585293-22585315 GGAAATAATTATATGGAGGATGG + Intergenic
1006643072 6:35498262-35498284 GGAAAGGATTCAGTGGAGGCTGG - Exonic
1006775938 6:36592649-36592671 AGAAAAGCTTACATAGAGGAGGG + Intergenic
1006813598 6:36836717-36836739 GGAGAGGAGCACAGGGAGGAGGG - Intronic
1006883466 6:37359640-37359662 GGATAGCATTTCTTGGAGGAGGG + Intronic
1007006566 6:38369226-38369248 AGAATGGATTTGATGGAGGATGG - Intronic
1008264138 6:49402937-49402959 GGACAAGAATCCATGGAGGAAGG + Intergenic
1008641806 6:53471613-53471635 GGAAAGGAAGACAGGAAGGAAGG - Intergenic
1010275660 6:73965915-73965937 GGAAAGGGTGACTTGGGGGATGG + Intergenic
1010326470 6:74569069-74569091 GAAAAGGATGAAAGGGAGGAAGG - Intergenic
1010560067 6:77338417-77338439 TTAAAGGAAGACATGGAGGAAGG - Intergenic
1010673059 6:78709578-78709600 GGAAACATTTTCATGGAGGAAGG + Intergenic
1012202670 6:96425156-96425178 GGCACCTATTACATGGAGGAAGG + Intergenic
1012309055 6:97698175-97698197 GCAAAGGTGCACATGGAGGAAGG + Intergenic
1013098157 6:106964763-106964785 GTAAAGGAGTACCTGGAGGAAGG + Intergenic
1018875842 6:167821744-167821766 GGAAAGGAGGACAAGGAGGCAGG + Intergenic
1019002369 6:168764933-168764955 GGAAAGCATCACATGGAAGAAGG - Intergenic
1020955498 7:14735304-14735326 GGAAAGGATTCCTTGGAGCTAGG - Intronic
1021629672 7:22632139-22632161 GGAGATGTGTACATGGAGGAGGG + Intronic
1022265399 7:28748833-28748855 GGAAAGGAATAAATGCAAGAGGG + Intronic
1022595687 7:31711740-31711762 AGAATGGATAATATGGAGGATGG - Intergenic
1023652909 7:42389722-42389744 GTAGAGGATTACAGAGAGGAAGG - Intergenic
1024824265 7:53371240-53371262 GGAAACACTCACATGGAGGAGGG + Intergenic
1025082472 7:55995628-55995650 GGGCAGGATTGGATGGAGGAAGG + Intronic
1025845294 7:65190943-65190965 GGAAAACATAACTTGGAGGATGG - Intergenic
1025895570 7:65696973-65696995 GGAAAACATAACTTGGAGGATGG - Intergenic
1027408319 7:77886480-77886502 GGAAAGGGGGAAATGGAGGAAGG - Intronic
1027901011 7:84114722-84114744 GGAAAAGCTTAAATAGAGGAAGG - Intronic
1028844716 7:95466787-95466809 GGCAAGTCTTACATGGAGGCAGG + Intergenic
1030191948 7:106818934-106818956 GGAAAGGATTAAAAGGAGATTGG + Intergenic
1031969953 7:128057236-128057258 AGAAAAGATTTCCTGGAGGAAGG + Intronic
1032626323 7:133595152-133595174 GGAAAGGAAGAGAAGGAGGATGG + Intronic
1033271937 7:139939825-139939847 GGAAAGCATTTCAAAGAGGAAGG + Intronic
1033611137 7:142964043-142964065 GCAATGGATTGAATGGAGGAGGG + Intergenic
1034151579 7:148920922-148920944 GAAAAGGCTTACAGAGAGGAGGG - Intergenic
1037274843 8:17166745-17166767 GGAAAGGGTGTCAAGGAGGAGGG + Intronic
1038249216 8:25887254-25887276 GGAAAGGATTCCAGGGGTGAGGG - Intronic
1038696867 8:29813949-29813971 TGATAGGATTACCTGAAGGATGG + Intergenic
1039645621 8:39279235-39279257 GGAAATGATTATATTTAGGAGGG + Intronic
1039833201 8:41234137-41234159 GGAAAGATTGGCATGGAGGAAGG - Intergenic
1042533950 8:69840401-69840423 GGAAAGGATGGGAAGGAGGAAGG + Intergenic
1042594310 8:70429461-70429483 AGAAAGGATGAAATGGAGGAAGG - Intergenic
1043609266 8:82042094-82042116 GTAAAACATTACATGGATGAAGG - Intergenic
1043813202 8:84768427-84768449 AGAAAGGATTCCATGGAGGAGGG - Intronic
1046162036 8:110378398-110378420 GGTAAGTCTTACATGGAGGCAGG - Intergenic
1046406621 8:113780887-113780909 GGAAAGTATTACATTGCAGATGG + Intergenic
1046508376 8:115165687-115165709 GGAAAGAATTACAGTGAGGCTGG + Intergenic
1047943563 8:129851248-129851270 GGAACATTTTACATGGAGGAGGG + Intronic
1048260913 8:132944349-132944371 GAATAGGATGACTTGGAGGATGG - Intronic
1048741821 8:137569111-137569133 GGCAAACATTACATGGGGGAAGG + Intergenic
1050043874 9:1523553-1523575 TGAAATCATTACATAGAGGAAGG - Intergenic
1051332196 9:16034122-16034144 CGAAAGAATTACCTGGGGGAAGG + Intronic
1052008639 9:23380558-23380580 GGAAAGTCTTAAATAGAGGAAGG - Intergenic
1053148791 9:35730079-35730101 GGGAATGATTACATGGATGGTGG + Intronic
1053242730 9:36509455-36509477 GGAATGGGTTGCAGGGAGGAGGG - Intergenic
1053588571 9:39486754-39486776 AAAAACAATTACATGGAGGAAGG + Intergenic
1053620649 9:39810784-39810806 GGAGAGGGTGAGATGGAGGAAGG + Intergenic
1053626060 9:39873151-39873173 GGAGAGGGTGAGATGGAGGAAGG - Intergenic
1053885638 9:42643660-42643682 GGAAAGGGTGGCAAGGAGGAAGG - Intergenic
1054217828 9:62377550-62377572 GGAGAGGGTGAGATGGAGGAAGG + Intergenic
1054224657 9:62451109-62451131 GGAAAGGGTGGCAAGGAGGAAGG - Intergenic
1054263514 9:62896660-62896682 GGAGAGGGTGAGATGGAGGAAGG - Intergenic
1054577734 9:66878540-66878562 AAAAACAATTACATGGAGGAAGG - Intronic
1055080097 9:72260278-72260300 AGAATAGATTACATGGATGATGG + Intergenic
1055348413 9:75360359-75360381 GGAAAGGAATAGAAAGAGGAGGG - Intergenic
1056031647 9:82559852-82559874 AGAAAGGAAGAAATGGAGGAGGG + Intergenic
1056932647 9:90891740-90891762 GGAAAAGATTCCTTGGAGCAGGG + Intronic
1057254041 9:93528982-93529004 GGAATGGACCACATGGATGATGG + Intronic
1058987716 9:110224331-110224353 GGGAAGGCTTACATGGTGGCAGG - Intergenic
1059202192 9:112428608-112428630 AGAGTGGATTGCATGGAGGAAGG + Intronic
1059354774 9:113690100-113690122 GGAAAGTCTGCCATGGAGGAAGG - Intergenic
1059838060 9:118179459-118179481 GGAAAGGCTTTAAAGGAGGAAGG + Intergenic
1059958752 9:119544878-119544900 GGAAATCATCAGATGGAGGAGGG - Intergenic
1060774929 9:126366071-126366093 GGAAAGGAAGACACAGAGGAGGG - Intronic
1061135825 9:128732762-128732784 GCAAAAGTTCACATGGAGGAGGG - Intronic
1061807434 9:133144300-133144322 GGAAAGGAAGGCAGGGAGGAGGG - Intronic
1061962550 9:133995417-133995439 GGAGAGGGTGACATGGAGGATGG + Intergenic
1188585399 X:31768340-31768362 GGAAAGGAGGAAATGGAAGAGGG - Intronic
1188621394 X:32229492-32229514 AGAAAGGTTCTCATGGAGGAAGG - Intronic
1189098214 X:38161966-38161988 GGAAAGCCTTACATGTAGGTGGG + Intronic
1190879682 X:54483509-54483531 GGAAAGGGTTAAATCGCGGAGGG - Intronic
1191776582 X:64821303-64821325 GGAAAGAATTCTAAGGAGGACGG + Intergenic
1191832345 X:65429388-65429410 GGAATGGAGTGCATGGGGGATGG - Intronic
1192875021 X:75220488-75220510 TAAAAGGATTACAGGAAGGAAGG - Intergenic
1194268576 X:91782297-91782319 GGAAAGGAGGAAATGGAGGAGGG - Intronic
1196051873 X:111314233-111314255 TGAAAGAATGACAGGGAGGAGGG - Intronic
1196701014 X:118668836-118668858 AGAAGGGATTAAAGGGAGGAGGG + Intronic
1196747794 X:119087116-119087138 GGAAAGGACTACTTGAAGGCAGG + Exonic
1197632385 X:128876291-128876313 GGAAAGGAGAACAGGGAGCAAGG + Intergenic
1198430559 X:136562372-136562394 GGAAAGGAAGACAGGAAGGAAGG - Intergenic
1199074615 X:143513654-143513676 GGAAGTGTTTACAGGGAGGAGGG - Intronic
1199214718 X:145251243-145251265 GGAAGTGTTTACAGGGAGGAGGG + Intronic
1200094628 X:153651467-153651489 GGAAATGATAACATGGGGCAGGG - Intergenic
1200585777 Y:5003211-5003233 GGAAAGGAGGAAATGGAGGAGGG - Intronic
1200801766 Y:7393534-7393556 GGGCAGGATTATATGGAGAAGGG - Intergenic