ID: 979492005

View in Genome Browser
Species Human (GRCh38)
Location 4:121338894-121338916
Sequence AGGAAAGGATTACATGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492005_979492011 11 Left 979492005 4:121338894-121338916 CCTCCTCCATGTAATCCTTTCCT 0: 1
1: 0
2: 2
3: 32
4: 355
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492005_979492015 25 Left 979492005 4:121338894-121338916 CCTCCTCCATGTAATCCTTTCCT 0: 1
1: 0
2: 2
3: 32
4: 355
Right 979492015 4:121338942-121338964 GTTTTCAGGAGTTCTGATGTTGG 0: 1
1: 0
2: 2
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492005 Original CRISPR AGGAAAGGATTACATGGAGG AGG (reversed) Intronic
902541821 1:17161216-17161238 AGGAAAGGGTGAAATGGATGTGG + Intergenic
902690926 1:18109755-18109777 AGGGAAAGGTTACATGGGGGAGG + Intronic
902795006 1:18795428-18795450 AGGGAAGGATGAGAAGGAGGGGG - Intergenic
903656900 1:24955036-24955058 ACAAAAGGATTACATGGAGATGG - Intronic
904626086 1:31803809-31803831 AGGAAAGGAGAAGAAGGAGGAGG + Intronic
905319086 1:37103019-37103041 AGGAGAGGATTAGGAGGAGGAGG + Intergenic
905641225 1:39591317-39591339 AGGGAAACATTCCATGGAGGAGG - Intergenic
906502254 1:46349854-46349876 AGGGTAGGGTTACTTGGAGGAGG + Intronic
907115408 1:51963827-51963849 GGGATAGGATTACATGCAGAGGG - Intronic
907433795 1:54430898-54430920 GGGAAAGGATTCCAGGGAGCAGG + Intergenic
909866306 1:80676602-80676624 AGGAAAAGATCACCAGGAGGTGG + Intergenic
914828140 1:151150595-151150617 AAGAAAGCATTTCAAGGAGGGGG - Intergenic
915504459 1:156344747-156344769 GGGGAAGGGTTGCATGGAGGAGG + Intronic
915507190 1:156365395-156365417 AGGATAGGAACAGATGGAGGGGG - Intronic
915742160 1:158126883-158126905 AGGAAAGGTTTAGAGGGAAGGGG + Intergenic
915863258 1:159470397-159470419 AGGAAAGCATTTCAGGCAGGAGG - Intergenic
915902578 1:159857052-159857074 ATGCAAGGATTAAATGGGGGAGG - Intronic
915937015 1:160095589-160095611 AGGAATGGCAGACATGGAGGTGG - Intronic
917176036 1:172236583-172236605 AGGAAAGGAGGAGAAGGAGGAGG + Intronic
918476599 1:184931942-184931964 AGGAAGGGAGAACATGGAGAGGG - Intronic
918716471 1:187793433-187793455 AGAAAATGATTACTTAGAGGAGG - Intergenic
919339860 1:196291231-196291253 ACGAAAGGATTTCATAGAGTGGG - Intronic
919410478 1:197235989-197236011 AGGAAAGGATAACATGTAGCAGG - Intergenic
920543548 1:206797298-206797320 AGGAAGGGAATTCATGGCGGAGG + Intergenic
920820303 1:209374083-209374105 AGGAAAGGACTGCATGGTGAAGG - Intergenic
921078221 1:211716888-211716910 AGGAAAGGATTACAAGAGGCTGG - Intergenic
922593006 1:226792766-226792788 AGGGAAAGATCACATGGAGTGGG + Intergenic
923386222 1:233467391-233467413 AGGAAGGGATTCCATCAAGGAGG + Intergenic
923457960 1:234181574-234181596 AGGCAAGGAAAAAATGGAGGAGG - Intronic
923619922 1:235570328-235570350 AGGAAAGAATTGGAGGGAGGTGG - Intronic
923788403 1:237090379-237090401 ATGAGAGGATTACATGAGGGAGG + Intronic
1063371062 10:5523475-5523497 AGGAAAAGATTCCATGGGGATGG + Intergenic
1063509677 10:6633577-6633599 ATGAAAGGATTACAGGGTGGAGG + Intergenic
1064394562 10:14970994-14971016 AGGAAGGGATAACATTGAAGAGG + Intronic
1068627260 10:59262845-59262867 AGGCTAGGATCTCATGGAGGTGG + Intronic
1069048852 10:63771094-63771116 AGGAAAGGCTCATCTGGAGGAGG - Intergenic
1069414855 10:68189560-68189582 AGGAAATGATCTCATGGAGGTGG - Intronic
1070395317 10:76007231-76007253 AGGGAAGGGTGACAAGGAGGCGG - Intronic
1070731948 10:78835324-78835346 AGGAAAGGATATTATGGAAGCGG + Intergenic
1071821841 10:89287544-89287566 ATGAAAGGAAGACATGAAGGAGG - Intronic
1073599125 10:104829775-104829797 AGGAAAGCATTTCAAGGAAGAGG - Intronic
1074268517 10:111929435-111929457 AGGATATGAATACTTGGAGGTGG - Intergenic
1074429597 10:113382611-113382633 AGGAAAGGAGAAGGTGGAGGAGG - Intergenic
1074900274 10:117810541-117810563 AGGAAAGGAGGCCATGGAAGGGG - Intergenic
1075302134 10:121334291-121334313 AGGAGAAGAGTAGATGGAGGTGG + Intergenic
1076342760 10:129760819-129760841 AGGACAGGAAGAGATGGAGGAGG - Intronic
1076765306 10:132630032-132630054 GGGAAAGGTGTTCATGGAGGAGG + Intronic
1078339178 11:10486806-10486828 AGGAAAGGAGGAGATGAAGGAGG + Intronic
1078969465 11:16390658-16390680 AGGGAAGGTTTTCATGGAGTAGG - Intronic
1079663538 11:23073565-23073587 AGGAATAGATTAGATTGAGGAGG - Intergenic
1080129055 11:28771387-28771409 TGGAAAGCATCACATGGTGGAGG - Intergenic
1080151072 11:29052660-29052682 AGGCAAGGTTTAAATGCAGGTGG + Intergenic
1080793792 11:35544496-35544518 AGGCACGTCTTACATGGAGGTGG - Intergenic
1083959455 11:66006576-66006598 AGGGAAGGGCTTCATGGAGGAGG - Intergenic
1085433219 11:76474530-76474552 AGGAAGGGATTACATAGATATGG + Intronic
1086590216 11:88507000-88507022 AGGATAGTAATAAATGGAGGAGG - Intronic
1086930694 11:92689790-92689812 AGGAGAGGATTATACAGAGGAGG + Intronic
1087115408 11:94519396-94519418 AGGAAAATAGTACATGTAGGCGG - Intergenic
1087462259 11:98460053-98460075 AGAAATGGATTAAATGGTGGGGG + Intergenic
1087689006 11:101297847-101297869 AGGAAAAGACCACATGGAGAAGG - Intergenic
1088322268 11:108566336-108566358 AGGTAAGGTGTGCATGGAGGGGG + Intronic
1088442933 11:109891860-109891882 AGGAAAGGTAGAAATGGAGGTGG - Intergenic
1088757902 11:112901874-112901896 AGGACAGGCTTATATGGAAGGGG + Intergenic
1091040825 11:132279614-132279636 CGGAAAGGATTCCAGGCAGGTGG - Intronic
1091214818 11:133894282-133894304 AGGAAAGGGTTCCATGGAAATGG + Intergenic
1093091741 12:14929141-14929163 CGGAAAAGAGTACAGGGAGGGGG - Intronic
1094309645 12:29065441-29065463 AGAAATGGCTTACATGCAGGTGG - Intergenic
1095814383 12:46405757-46405779 AGGAAAAGATTTCACGGAAGTGG + Intergenic
1096256084 12:50063183-50063205 GGGCAGGGATTCCATGGAGGGGG + Intronic
1097355809 12:58600261-58600283 AGGAAAATATTACATGTGGGAGG + Intronic
1097542273 12:60955994-60956016 ATAAAAGGATTACAGGGTGGAGG + Intergenic
1098091642 12:66908378-66908400 AGGAGAGGATTTCAAGAAGGAGG + Intergenic
1098293691 12:68982809-68982831 AGGAAAGGATTAAGGGGTGGGGG + Intergenic
1101371544 12:104136271-104136293 AGGAAACAATTAAATGGGGGAGG + Intronic
1101668693 12:106845923-106845945 AAGAAAGTATTTCAAGGAGGAGG - Intronic
1102640008 12:114358856-114358878 AGGAAAGGAATCAAGGGAGGAGG - Intronic
1102686249 12:114727087-114727109 AAGAAAGAAAGACATGGAGGAGG - Intergenic
1103310602 12:120004225-120004247 GGGAAAGGGATAAATGGAGGGGG - Intronic
1105022577 12:132827226-132827248 AGGAAAAGAGTACCTGGTGGAGG + Intronic
1108598701 13:51972346-51972368 GGGAAAGAATTAGAGGGAGGAGG - Intronic
1112157313 13:96832050-96832072 ACGATAGGGTTACATGAAGGAGG - Intronic
1112421304 13:99251919-99251941 AGAAAAGCAATACATGGAAGGGG - Intronic
1112822529 13:103353411-103353433 AGAAAAGGATTTTGTGGAGGGGG + Intergenic
1114536375 14:23425506-23425528 AGAAAAGGATTGCAGGGAGGAGG + Intronic
1116089376 14:40285414-40285436 AAGAAAGAATCACATGGTGGAGG - Intergenic
1116480075 14:45386663-45386685 AGTAAAGTATTTCTTGGAGGAGG + Intergenic
1117369498 14:55063254-55063276 TGGAAAGGATTACTGGGAGTAGG - Exonic
1117628492 14:57665059-57665081 AGGAAAGGAGAAGATGGAAGAGG - Intronic
1119350319 14:73959251-73959273 AGGAAAGGCTTGCATGCATGTGG - Intronic
1119719255 14:76880139-76880161 AGGGAAGGTTTCCCTGGAGGAGG - Intergenic
1119769107 14:77209388-77209410 AGGAAAGAATAAAATGTAGGTGG - Intronic
1120618178 14:86733037-86733059 ATGAAAGGATTATAGGGTGGAGG - Intergenic
1123915973 15:25027755-25027777 AGGAAAGGAATGGATGGAAGGGG + Intergenic
1124001081 15:25760682-25760704 AGGAATTAATTACATGGAGCTGG + Intronic
1124866121 15:33493016-33493038 GGGAAAGGAATACATGGGAGAGG + Intronic
1126389059 15:48126325-48126347 AAGATAGGATTACAGGAAGGGGG - Intronic
1126773228 15:52078094-52078116 AGGAAAGGGTTCCATGCAGAGGG - Intergenic
1127521143 15:59744200-59744222 AAGCAAGCATTTCATGGAGGAGG + Intergenic
1128690886 15:69723995-69724017 AGGACAGAATTACAAGGTGGAGG + Intergenic
1129043230 15:72708743-72708765 AGGAATGCATTCCTTGGAGGAGG + Intronic
1129362011 15:75029985-75030007 AGGAAAGGGTTGCCTGGAGCAGG + Intronic
1129872500 15:78949597-78949619 AGGAAAAGAATAAATGGATGTGG - Intergenic
1130094575 15:80846377-80846399 AGGAAAGGTTTTCCTGGGGGAGG - Intronic
1130415279 15:83688078-83688100 AGGAAAGGAATGGATGGAGAAGG + Intronic
1131077992 15:89510319-89510341 AGGAAAGGAATTCCAGGAGGAGG + Intergenic
1131670546 15:94615121-94615143 AGGAAAGGATGACAACAAGGAGG + Intergenic
1131931796 15:97450622-97450644 AGGATAAGAAGACATGGAGGAGG + Intergenic
1134809624 16:17156473-17156495 GGGCAAGGATTCCATGGAGGTGG - Intronic
1134863217 16:17579503-17579525 AGGAAGGGAGACCATGGAGGGGG + Intergenic
1135208269 16:20500537-20500559 AGGACATGATTACATTGAGGAGG - Intergenic
1135210630 16:20523163-20523185 AGGACATGATTACATTGAGGAGG + Intergenic
1137869215 16:51933406-51933428 AGGAAAGGATCAGAAGGAGCAGG - Intergenic
1138486999 16:57352189-57352211 AGGAATGGATTACAAGAATGTGG - Intergenic
1138535151 16:57656028-57656050 AGGAAAGGGTGACATGGCCGAGG - Intronic
1139499890 16:67354202-67354224 AGTAAAGCATTACAAGCAGGGGG - Intronic
1141465709 16:84204693-84204715 AGCACAGGATCCCATGGAGGGGG + Intergenic
1142902639 17:3021958-3021980 AGGAAATCAGTACATGGAAGAGG - Intronic
1146477872 17:33177508-33177530 AGGAAAGGGTGAGCTGGAGGTGG + Intronic
1147577379 17:41610567-41610589 AGAAAAAGAGTCCATGGAGGTGG + Intronic
1148458874 17:47826401-47826423 AGGAAAGGCAGACATGGAGCAGG - Intronic
1149041721 17:52197880-52197902 AGGAAAGGATAGAAAGGAGGAGG + Intergenic
1149432949 17:56609025-56609047 AGGAAAGGTGTTCATTGAGGAGG - Intergenic
1150666924 17:67148532-67148554 ACGAAAGTATGACACGGAGGGGG + Intronic
1151457301 17:74233645-74233667 AGGAAAGGAGGACTTGGAGCAGG - Intronic
1153805019 18:8704126-8704148 AGGTAATAATTACAAGGAGGAGG - Intergenic
1154971372 18:21413108-21413130 AGGAAAGGAGGCCATGGTGGAGG - Intronic
1156735760 18:40257089-40257111 AGGAAAGTATTTCATGGACCAGG - Intergenic
1157251167 18:46097663-46097685 AGGAAAGGAATAAATGAAGGTGG - Intronic
1159722754 18:71913735-71913757 AGGAAGGGATGACAGTGAGGGGG - Intergenic
1160204388 18:76821710-76821732 AGGAAAGGGTTACAGAGAGACGG + Intronic
1161044370 19:2127205-2127227 AGGAAAGGAACACAGGGAAGCGG + Intronic
1161213326 19:3079777-3079799 AGGAAAGGGAGACAGGGAGGAGG + Intergenic
1161416786 19:4151728-4151750 AGGAGAGGAAGACAGGGAGGAGG - Intergenic
1162272490 19:9627910-9627932 GGGACAGGATTATATGGGGGAGG - Intronic
1162314962 19:9933221-9933243 AGAAAAAGATTACAAGGTGGGGG - Intronic
1164235013 19:23324081-23324103 AGGAAAGGAAGAGAAGGAGGAGG - Intronic
1164459305 19:28433870-28433892 ATAAAAGGATTACAGGGTGGAGG + Intergenic
1165249160 19:34515688-34515710 ATGAAAGGATTATAGGGTGGGGG - Intergenic
1165313113 19:35040304-35040326 AGGAGTGCATTACAGGGAGGGGG - Intronic
1166176497 19:41075462-41075484 AGGCAAGGATTACAAGGTGATGG - Intergenic
1166385531 19:42378510-42378532 AGGACAGGAGTCCAAGGAGGTGG - Intronic
1167024943 19:46908895-46908917 AAGCAGGGATTGCATGGAGGTGG + Intergenic
1167265454 19:48480820-48480842 AGGAAAGGGTGACATAGTGGCGG - Intronic
924985267 2:264489-264511 AGGAGAGGGGTACCTGGAGGAGG - Intronic
925828896 2:7876641-7876663 ATAAAAGGATTACAAGGTGGAGG + Intergenic
925831631 2:7902005-7902027 AGGTAATGATTAGAAGGAGGGGG + Intergenic
925897931 2:8487639-8487661 AGGAAAGGATTCCTTAGGGGAGG + Intergenic
926967136 2:18427326-18427348 AGGAAAGGACCACATACAGGGGG + Intergenic
928645966 2:33352950-33352972 AAGAAAGGCTTACAAGGGGGAGG - Intronic
928654821 2:33439736-33439758 AGGAAAGAAGTGCCTGGAGGAGG + Intronic
929788001 2:45005772-45005794 AGGAAAGCAATACAAGGAGAGGG + Exonic
931798939 2:65740111-65740133 AGGAAAGGGAGACAAGGAGGTGG + Intergenic
931990515 2:67785406-67785428 AGGAATGGAGTACAGGGAAGAGG - Intergenic
932159541 2:69447669-69447691 ATAAAAGGATTACAGGGTGGGGG + Intergenic
932207740 2:69898351-69898373 AGGGAGGGATTATATAGAGGAGG + Intronic
933397512 2:81752344-81752366 GGGAAAAGATCACATGGAGAAGG + Intergenic
934965142 2:98715012-98715034 AAGAAAGAAATACATGAAGGAGG + Intronic
935082524 2:99812216-99812238 AGGAAAGGAAAAAATGGAGAGGG - Intronic
935274805 2:101466905-101466927 AGGAGAGGAGGACAAGGAGGAGG + Intronic
936174524 2:110208099-110208121 AGGAAAGGATCAGAGGGAGGGGG + Intergenic
937325147 2:120985825-120985847 GGGAAAGGATGACCAGGAGGGGG - Intronic
937447431 2:121970853-121970875 AGGAAAGGACTCCATGGATGTGG - Intergenic
937815380 2:126244897-126244919 AGGAAAGCATGGGATGGAGGTGG + Intergenic
937903733 2:127041580-127041602 AGGAAAGGATAGGCTGGAGGTGG - Intergenic
938624254 2:133091296-133091318 AGGAAAGGTTTCCATGGGGAAGG - Intronic
939460810 2:142493849-142493871 ACAAAAGGATTACAGGGTGGAGG + Intergenic
939862502 2:147436591-147436613 AAGAAGGGCATACATGGAGGTGG + Intergenic
940022644 2:149171604-149171626 AGGAAAGGAGTATATGGAAAGGG + Intronic
940769339 2:157823947-157823969 AGGAAAAGATTACATGGGCCAGG - Intronic
941407853 2:165114052-165114074 ATGAAATGATTACCTGGAAGTGG - Intronic
942135338 2:172919598-172919620 AGGAAAGGATGCCATGGAAGAGG - Intronic
943670055 2:190649850-190649872 AGGAGAGTTTTACATGGAAGTGG + Exonic
943865272 2:192919762-192919784 ATAAAAGGATTACAGGGTGGAGG - Intergenic
944482326 2:200170712-200170734 AGGACAGTATTTCAAGGAGGAGG - Intergenic
944521639 2:200575915-200575937 AGGAATGGATAAATTGGAGGAGG - Intronic
944534636 2:200696830-200696852 AGGAAAGGGTGACAAGAAGGAGG + Intergenic
944586216 2:201176103-201176125 AGGAAAGTATAACTTGGAAGAGG + Exonic
946369510 2:219272072-219272094 GGAGAAGGATTACAAGGAGGTGG + Intronic
948458396 2:238117855-238117877 AGGAGAGGGATACATGGAGGGGG + Intronic
948666337 2:239536911-239536933 AGGCAGGGGTTCCATGGAGGAGG - Intergenic
1169115863 20:3065530-3065552 AGGACAGGGTTTCACGGAGGAGG - Intergenic
1169603728 20:7291652-7291674 AGGAAAGGCTTTCATAGAAGAGG + Intergenic
1169851697 20:10059295-10059317 AGTAAAGGATCACATAGGGGAGG - Intergenic
1170060510 20:12253977-12253999 AGGAGGGGATTACATGAATGCGG + Intergenic
1170135265 20:13066769-13066791 AGGAAAGGAAGAGAAGGAGGAGG - Intronic
1170563425 20:17578327-17578349 AGGACAGGTTCCCATGGAGGTGG + Intronic
1172371207 20:34393580-34393602 AAGAAAGTAAAACATGGAGGAGG + Intronic
1173283554 20:41650384-41650406 AAGAAAGGAAAACATGAAGGAGG + Intergenic
1173702456 20:45085019-45085041 AGGAAAAGATGGCAGGGAGGTGG + Intergenic
1174771021 20:53300595-53300617 AGAAAAGGATGACATGGAGGGGG - Intronic
1175647265 20:60685157-60685179 AGGAAATGATGACTAGGAGGCGG - Intergenic
1176184329 20:63769978-63770000 AGGAAAGGACTGCAGGGAGCTGG + Intronic
1176659631 21:9622257-9622279 AGGGAAGGATATCATGGAGTTGG + Intergenic
1178033012 21:28549518-28549540 TGGCAAGGACTGCATGGAGGAGG - Intergenic
1178955373 21:37017164-37017186 AAAAAAAGATTACAGGGAGGGGG + Intronic
1179076594 21:38128111-38128133 AGGACAGAAATACATGTAGGAGG + Intronic
1179524309 21:41965779-41965801 AAGAAAGGATTCCACGGTGGGGG + Intergenic
1182754576 22:32668492-32668514 AGGAAAGGAGTGAAGGGAGGAGG - Intronic
1183101870 22:35589082-35589104 AGGAAAGGATGTGAAGGAGGTGG + Intergenic
1183528547 22:38338992-38339014 TGGCAAGGATTACATGAAAGAGG - Intronic
1183993695 22:41617143-41617165 AGGAACGTATTACACAGAGGTGG + Intronic
1184863872 22:47191995-47192017 AGGAGAGGGATAGATGGAGGAGG + Intergenic
949291258 3:2468904-2468926 AGGAAAGTCTTACATGGAAGAGG - Intronic
950139413 3:10604889-10604911 GGGAAAGCTGTACATGGAGGAGG - Intronic
950647273 3:14384591-14384613 GAGAAAGGCTTACATGGTGGGGG - Intergenic
950926420 3:16746047-16746069 ATGAAAGGATTATAGGGTGGAGG - Intergenic
950954334 3:17035476-17035498 ATGAACACATTACATGGAGGAGG - Intronic
952231957 3:31440933-31440955 AGGAAAGGAAAACATGGGGCTGG + Intergenic
952292315 3:32029468-32029490 AAGAAAGGATTTCACTGAGGGGG - Intronic
953382935 3:42487661-42487683 TGGAAAGGTCTACATGGAGGAGG + Intergenic
954068194 3:48123791-48123813 CGGAAAAGATTTCATGGAGGAGG + Intergenic
954576271 3:51678046-51678068 AGATAAGGATCACATGTAGGCGG + Intronic
955387017 3:58488336-58488358 AGTAAAGGAATCCATGGAGGTGG + Intergenic
958271363 3:91503473-91503495 TGGTAAGGATTCCATGGAAGAGG - Intergenic
961103419 3:124221113-124221135 TGAAAAGGAGTGCATGGAGGAGG - Intronic
961345363 3:126260378-126260400 GGGAAAGGAGGACAGGGAGGAGG - Intergenic
961409194 3:126706004-126706026 TGGCAAGGATTAAATGGGGGAGG + Intronic
961921389 3:130429989-130430011 AGGAAAGGTTTACAAGTAGTGGG - Intronic
962283179 3:134067149-134067171 AGGAAAGGATGCCAAGGAGGAGG - Intronic
962394347 3:135001719-135001741 AGAGAAGGATAACATAGAGGAGG - Intronic
962415630 3:135178916-135178938 AGGAATTGTTTACATGGTGGTGG - Intronic
963347642 3:144114959-144114981 AAGCAGGGATTACAGGGAGGGGG - Intergenic
964678512 3:159311063-159311085 AGGAAAGGAGAGCATGGAAGTGG - Intronic
965084172 3:164072993-164073015 AGGACATGATTACTTGCAGGTGG + Intergenic
965450749 3:168834691-168834713 AGGAAAGTACTGCATGGAGAGGG + Intergenic
966621374 3:181967975-181967997 AGGAGAGGATTTCAAGTAGGTGG + Intergenic
967174943 3:186854267-186854289 AGGAAAGGAGAACCTGGAGAAGG + Exonic
968740724 4:2330529-2330551 AGGAAGGGACAGCATGGAGGAGG + Intronic
969570954 4:8007957-8007979 AGGCAAGGCTTAGATGTAGGGGG + Intronic
970192931 4:13532271-13532293 AGAAAAGAAATACATTGAGGGGG - Intergenic
971174284 4:24265905-24265927 AGGAAAGGACTAAAAAGAGGGGG + Intergenic
973652277 4:53007989-53008011 AGGAGAGGGTTACAGGAAGGTGG + Intronic
974720705 4:65734824-65734846 AGGAAAGAATTCCATTGAGGTGG + Intergenic
975654659 4:76629548-76629570 AGGCAAGGATTCCAGTGAGGAGG + Intronic
976227634 4:82808701-82808723 AGGAAATCAGTACATGGAAGAGG + Intergenic
976309661 4:83598252-83598274 AGAAAAGCATGACATGGAGAAGG - Intronic
976734646 4:88297186-88297208 GGGCAAGGAATACATGCAGGGGG - Intergenic
977047919 4:92090525-92090547 AGGAAAGCATTGCATGCAGCGGG + Intergenic
977198509 4:94088608-94088630 ATGAAAAGATTACAGGGTGGAGG + Intergenic
979492005 4:121338894-121338916 AGGAAAGGATTACATGGAGGAGG - Intronic
980145498 4:128978619-128978641 AGGAGAAGAATAGATGGAGGGGG + Intronic
980472520 4:133267703-133267725 ATAAAAGGATTACAGGGTGGAGG + Intergenic
982037489 4:151360390-151360412 AGGAAAGAATTTCAAGGAGTGGG + Intergenic
984192799 4:176625242-176625264 CGCAAAGGAGTCCATGGAGGGGG + Intergenic
984772840 4:183453276-183453298 AGGGAAGGATGTCAAGGAGGAGG + Intergenic
985389949 4:189483447-189483469 ATAAAAGGATTACAGGGTGGAGG + Intergenic
986313325 5:6570994-6571016 AGGAAAGGAAGAGAGGGAGGAGG + Intergenic
987902526 5:24031331-24031353 AGGAATGGATTCCTTGGGGGAGG + Intronic
988399302 5:30741342-30741364 GGGAAAGGATAGAATGGAGGAGG - Intergenic
989602190 5:43210605-43210627 AGGAAAACATTATATGCAGGGGG + Intronic
990305552 5:54491227-54491249 AGGAATTGATTTCATGGAAGTGG + Intergenic
992107023 5:73457849-73457871 GGGAAAGGATTCCAAGCAGGAGG + Intergenic
992750695 5:79857886-79857908 AGGAAAGGAGGACAAGGAGGAGG + Intergenic
993220341 5:85087456-85087478 AGGAAAGGATGAAATAAAGGAGG - Intergenic
993817706 5:92572903-92572925 TGGAAAAGATTACATGGGGTGGG - Intergenic
994583369 5:101675806-101675828 AGGAAAGGAGTAGAGGCAGGTGG - Intergenic
994946675 5:106402727-106402749 AGAAAGGGATTAAATGAAGGAGG + Intergenic
997413327 5:133706824-133706846 GGGACAGGATGACATGGAGGAGG + Intergenic
997449300 5:133968716-133968738 AAGGAAGGATTGCAGGGAGGAGG + Exonic
998714481 5:144867453-144867475 AGGAAATATTTACATGTAGGGGG - Intergenic
999068729 5:148719393-148719415 AGGAAGGGATTACTAGGTGGCGG + Intergenic
999618943 5:153453694-153453716 ATGAAAAGATTACAGGGTGGAGG + Intergenic
999638144 5:153643881-153643903 AGGAAAGGGTGAGATGGGGGTGG - Intronic
1001191461 5:169636769-169636791 AGTAAATGTTTACCTGGAGGTGG - Intergenic
1001292738 5:170475741-170475763 AGGAGGGGAGGACATGGAGGTGG - Intronic
1001320453 5:170676215-170676237 AGGAAAGGATTACAGGTGGGAGG + Intronic
1003121686 6:3323496-3323518 ATGAATGGATTGCAGGGAGGTGG - Intronic
1003557254 6:7151158-7151180 AAGATAGGATTACGTGAAGGGGG - Intronic
1004040177 6:11967571-11967593 AGGAAAGAATTAAATGTATGTGG + Intergenic
1005510581 6:26508658-26508680 AGGAAGGCATTACTGGGAGGTGG + Exonic
1006463135 6:34175607-34175629 AGGAAAAGGTTACAAGGAAGAGG - Intergenic
1006813599 6:36836718-36836740 AGGAGAGGAGCACAGGGAGGAGG - Intronic
1006883465 6:37359639-37359661 AGGATAGCATTTCTTGGAGGAGG + Intronic
1007225527 6:40311131-40311153 ATGAAAGGAGTTCAGGGAGGAGG + Intergenic
1007427487 6:41756889-41756911 AGGCAGGGGCTACATGGAGGAGG - Intergenic
1007616721 6:43184240-43184262 AGAAAAAAAATACATGGAGGGGG - Intronic
1008134493 6:47758054-47758076 CTGAAAGGATTTCATGCAGGAGG + Intergenic
1008837327 6:55850613-55850635 AGGAAAGGATTACTGTGAGGAGG - Intronic
1008929701 6:56925759-56925781 AGCAGAGGATTAAATTGAGGGGG - Intronic
1008983771 6:57517835-57517857 TGGTAAGGATTCCATGGAAGAGG + Intronic
1009171830 6:60410744-60410766 TGGTAAGGATTCCATGGAAGAGG + Intergenic
1011986014 6:93446872-93446894 ATGAAAGGTTTAAATGGAAGAGG - Intergenic
1012319566 6:97825936-97825958 AGGAAAGGATTCCCTGGAATAGG - Intergenic
1013428647 6:110036699-110036721 AGGATAGCATTCCATGAAGGTGG - Intergenic
1014141516 6:117948907-117948929 AGGGAAGCAGTACATGGAAGGGG + Intronic
1014362053 6:120490456-120490478 AGAAAAGCTTTACATGGAGTGGG + Intergenic
1014416406 6:121190253-121190275 AGGAAAGGATGAGGTGGAGGGGG - Intronic
1014416414 6:121190280-121190302 AAGAAAGGATAAGGTGGAGGGGG - Intronic
1014682177 6:124445223-124445245 AGGAAAGGATTAGAAGGTGGAGG + Intronic
1015017010 6:128425550-128425572 AGGAAAGGAGTAGATGGAATTGG - Intronic
1016072865 6:139761354-139761376 AGAATAGGATTAATTGGAGGAGG - Intergenic
1016607321 6:145945407-145945429 GGGAAAGAATTACAAGGAAGAGG - Exonic
1018016505 6:159717057-159717079 AGGAAAGAATTACAGGGATCAGG + Intronic
1019009909 6:168836111-168836133 AGGAAATGGTTACATGGAAGAGG - Intergenic
1021384350 7:20009533-20009555 AGGGAGGGATTTCTTGGAGGTGG + Intergenic
1021584437 7:22193025-22193047 TGGAAAGAAATACAAGGAGGAGG - Intronic
1021629671 7:22632138-22632160 AGGAGATGTGTACATGGAGGAGG + Intronic
1021635715 7:22690443-22690465 GGGAAAGAATAACATGGAGTGGG + Intergenic
1023107800 7:36779761-36779783 AGGAAAAGAGTGAATGGAGGTGG + Intergenic
1026411740 7:70130103-70130125 AGAAAAGCATAACATGAAGGTGG + Intronic
1027452558 7:78349495-78349517 AGAAAATAATTACATGCAGGTGG - Intronic
1029428441 7:100512902-100512924 AGAAAAGGATGCCATGCAGGAGG + Intergenic
1030163698 7:106532421-106532443 ATAAAAGGATTATAGGGAGGGGG + Intergenic
1031304553 7:120110231-120110253 AGGAATGCATTACTTGGGGGAGG + Intergenic
1031959490 7:127976027-127976049 AGGAAAGGAGAACAGGGTGGAGG - Intronic
1033466844 7:141599646-141599668 AGGAAAGGATCAGTTGGAAGTGG - Intronic
1033992851 7:147309059-147309081 AGGAAAAGATTACAGTTAGGTGG - Intronic
1035942333 8:3915481-3915503 AGGAAAGGATGACATGAAACAGG + Intronic
1037274842 8:17166744-17166766 AGGAAAGGGTGTCAAGGAGGAGG + Intronic
1038249217 8:25887255-25887277 AGGAAAGGATTCCAGGGGTGAGG - Intronic
1038386742 8:27155674-27155696 AGGAAAGAATTACATTGTGCTGG - Intergenic
1039648935 8:39319786-39319808 AGGAAAGGCTTTTATGGAAGAGG + Intergenic
1039857756 8:41431106-41431128 AAAAAAGGATTACATGGGGTTGG + Intergenic
1041723857 8:61000286-61000308 AGGAAAGGATTTCTGGAAGGAGG + Intergenic
1043717977 8:83509128-83509150 ATAAAAGGATTACAGGGTGGAGG + Intergenic
1043813203 8:84768428-84768450 CAGAAAGGATTCCATGGAGGAGG - Intronic
1043949722 8:86294741-86294763 TGGAAACGATTACATGGAATAGG + Intronic
1044415600 8:91935727-91935749 AGGAAAGGACGCCATGTAGGTGG + Intergenic
1044543042 8:93429185-93429207 AGGGAAGGAGGACATGGTGGGGG + Intergenic
1045435386 8:102158319-102158341 ACGAAAAGAGGACATGGAGGGGG - Intergenic
1046364551 8:113209602-113209624 AGTAAAGGATTAGCTGGAGTGGG + Intronic
1046368983 8:113275624-113275646 AGTAAATGATTATATAGAGGAGG + Intronic
1047499955 8:125432759-125432781 AGGAACAGATGACTTGGAGGGGG - Intronic
1048142596 8:131809139-131809161 AGGAAAGGAAGTCAAGGAGGTGG - Intergenic
1050117520 9:2277283-2277305 ATGAACGGATTACAGGGTGGAGG - Intergenic
1051108787 9:13611038-13611060 TGGAAAGGAAGAAATGGAGGTGG - Intergenic
1051521337 9:17992162-17992184 AGGAAAGGATAACCTGGACAGGG - Intergenic
1052345366 9:27404079-27404101 AGGAAAGTATAATAGGGAGGGGG - Intronic
1052779920 9:32770944-32770966 AAAAGTGGATTACATGGAGGTGG + Intergenic
1052804111 9:32997476-32997498 AGGAAAAAATTTCCTGGAGGAGG + Intronic
1052982698 9:34460439-34460461 AGCAAAGGCTAACATGGAGGTGG - Intronic
1053427403 9:38019507-38019529 AGGAAAGGACTAGAGGAAGGTGG + Intronic
1053443517 9:38134948-38134970 AGGACATGATGACATGCAGGGGG + Intergenic
1053595085 9:39552436-39552458 AGGTAAGGAGTAAATGGAGCTGG - Intergenic
1053652936 9:40187735-40187757 AGGTAAGGCCTGCATGGAGGAGG + Intergenic
1053852866 9:42307464-42307486 AGGTAAGGAGTAAATGGAGCTGG - Intergenic
1053903341 9:42817043-42817065 AGGTAAGGCCTGCATGGAGGAGG + Intergenic
1054531647 9:66188486-66188508 AGGTAAGGCCTGCATGGAGGAGG - Intergenic
1054571174 9:66812538-66812560 AGGTAAGGAGTAAATGGAGCTGG + Intergenic
1055348414 9:75360360-75360382 AGGAAAGGAATAGAAAGAGGAGG - Intergenic
1055955063 9:81765730-81765752 AGGAAATAATTAACTGGAGGTGG - Intergenic
1056189643 9:84172419-84172441 AAGAAAGGATGAAGTGGAGGGGG + Intergenic
1056932646 9:90891739-90891761 AGGAAAAGATTCCTTGGAGCAGG + Intronic
1057745380 9:97746884-97746906 AGGAAAGGGTGAAATGGATGTGG - Intergenic
1057979536 9:99646264-99646286 AGAAAAGGATTATAGGCAGGTGG + Intergenic
1058337028 9:103842653-103842675 ACAGAAGGAGTACATGGAGGTGG + Intergenic
1058396162 9:104556804-104556826 AGGAAAAGATCACAGGGAGAAGG + Intergenic
1058808945 9:108620326-108620348 AGGAAAGGAGGAGAAGGAGGAGG + Intergenic
1059958753 9:119544879-119544901 AGGAAATCATCAGATGGAGGAGG - Intergenic
1060685647 9:125608928-125608950 AGCAAAAGGTTAGATGGAGGTGG + Intronic
1060870683 9:127037611-127037633 AGGAAAGCAGAACCTGGAGGTGG - Intronic
1061135826 9:128732763-128732785 AGCAAAAGTTCACATGGAGGAGG - Intronic
1061423264 9:130483744-130483766 AGGAAAGGAAGGCAAGGAGGAGG - Intronic
1061492992 9:130956600-130956622 GGGAAAGGATTAGATGGGGTGGG + Intergenic
1185763250 X:2704405-2704427 AGAAAAAGATTATATGCAGGTGG - Intronic
1186253193 X:7691418-7691440 AGGAAAGAATTAAAGGAAGGAGG - Intergenic
1186270863 X:7886735-7886757 AGGAAATGAGTAAACGGAGGTGG + Intergenic
1187399414 X:18946596-18946618 AGGAAAGGAGTAGATTTAGGAGG - Intronic
1187527100 X:20064120-20064142 AGGGAAGGGTTCCCTGGAGGAGG + Intronic
1187683937 X:21797843-21797865 AGAAAAGCATTCCATGGAGCAGG - Intergenic
1187935845 X:24335038-24335060 AGGAAAGTATAACTTAGAGGAGG + Intergenic
1188243497 X:27815339-27815361 AGTAAACAATTACATGGAAGGGG - Intronic
1188245950 X:27835895-27835917 AGTAAACAATTACATGGAAGGGG - Intergenic
1188463456 X:30453084-30453106 ATAAAAGGATTACAGGGGGGAGG + Intergenic
1188585400 X:31768341-31768363 AGGAAAGGAGGAAATGGAAGAGG - Intronic
1188894524 X:35650696-35650718 GGGAAAGGATTTCATTGAAGTGG + Intergenic
1189098213 X:38161965-38161987 AGGAAAGCCTTACATGTAGGTGG + Intronic
1189414704 X:40803736-40803758 AGGCAAGGATTTCTAGGAGGGGG + Intergenic
1192925560 X:75751499-75751521 AGGAAAGTATTACAAGGAGGAGG - Intergenic
1193058597 X:77180855-77180877 AGGAACGAATAAGATGGAGGGGG - Intergenic
1193225914 X:78984693-78984715 AGGTAAGTCCTACATGGAGGAGG + Intergenic
1194268577 X:91782298-91782320 AGGAAAGGAGGAAATGGAGGAGG - Intronic
1194429391 X:93782337-93782359 AGGACAGTATTACAAGCAGGTGG + Intergenic
1194807477 X:98347400-98347422 AGAAAATGATTACTTAGAGGTGG + Intergenic
1195937572 X:110140143-110140165 AGGGAGGGTATACATGGAGGGGG + Intronic
1196051874 X:111314234-111314256 ATGAAAGAATGACAGGGAGGAGG - Intronic
1196931368 X:120684938-120684960 AGGAAATGAGGAGATGGAGGAGG - Intergenic
1197427527 X:126316103-126316125 ATTAAAGGATTACATGGAAAAGG - Intergenic
1198329841 X:135612074-135612096 ACGAAATTATTACATGGAGCAGG - Intergenic
1198499038 X:137224288-137224310 AGGAAAGGAATAAATGATGGGGG - Intergenic
1199211787 X:145220778-145220800 AGGAAATTAATACATGTAGGAGG - Intergenic
1199800706 X:151248215-151248237 AGGAAAGGGTTGGGTGGAGGGGG + Intergenic
1200585778 Y:5003212-5003234 AGGAAAGGAGGAAATGGAGGAGG - Intronic
1200798296 Y:7361924-7361946 AGGAGAAGACTACATGGAGGCGG - Intergenic
1201581314 Y:15514094-15514116 ATAAAAGGATTACAGGGTGGAGG - Intergenic
1201724891 Y:17140690-17140712 ATGAAAGGATTATAGGGTGGAGG + Intergenic
1201753323 Y:17458798-17458820 AGGAAAACATAACATGGTGGTGG + Intergenic
1201848230 Y:18447185-18447207 AGGAAAACATAACATGGTGGTGG - Intergenic
1202061978 Y:20897930-20897952 ATAGAAGGATTACAGGGAGGAGG - Intergenic
1202083137 Y:21105509-21105531 AGGGAAGAGTTATATGGAGGTGG - Intergenic