ID: 979492006

View in Genome Browser
Species Human (GRCh38)
Location 4:121338897-121338919
Sequence GTAAGGAAAGGATTACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492006_979492015 22 Left 979492006 4:121338897-121338919 CCTCCATGTAATCCTTTCCTTAC 0: 1
1: 0
2: 1
3: 18
4: 253
Right 979492015 4:121338942-121338964 GTTTTCAGGAGTTCTGATGTTGG 0: 1
1: 0
2: 2
3: 26
4: 254
979492006_979492011 8 Left 979492006 4:121338897-121338919 CCTCCATGTAATCCTTTCCTTAC 0: 1
1: 0
2: 1
3: 18
4: 253
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492006 Original CRISPR GTAAGGAAAGGATTACATGG AGG (reversed) Intronic
901774973 1:11554313-11554335 GAAAGGAAGGGTTTACCTGGTGG - Intergenic
902653178 1:17850114-17850136 GAAAGGCAAGTCTTACATGGCGG - Intergenic
903645185 1:24891267-24891289 GCAAGGAATGTCTTACATGGTGG + Intergenic
904351726 1:29912089-29912111 GGAGGGTAAGGAGTACATGGGGG + Intergenic
904481749 1:30798213-30798235 GGTAGGAAAATATTACATGGTGG + Intergenic
905415199 1:37799267-37799289 ATAATGAATGGATTATATGGAGG + Intronic
906502253 1:46349851-46349873 GTAAGGGTAGGGTTACTTGGAGG + Intronic
907839629 1:58143967-58143989 GGAAGGAAGGAATTAAATGGAGG - Intronic
909306820 1:74091796-74091818 GTAAAGAAAGTATTTAATGGAGG - Intronic
910103697 1:83607020-83607042 GTAATGAAAGCATGAGATGGGGG + Intergenic
910201827 1:84707925-84707947 GTAAAGAAAGTAATAAATGGTGG + Intergenic
910472249 1:87567178-87567200 GTAAGCAGAGAATTACATGTTGG + Intergenic
911790804 1:102013505-102013527 GAAAGGCACGTATTACATGGCGG - Intergenic
912265332 1:108151502-108151524 GGAAGGAAACGGTTTCATGGGGG - Intronic
912934091 1:113987702-113987724 GTAAGGGACGTCTTACATGGAGG + Intergenic
917202168 1:172529306-172529328 GGAAGGGAATGATTACATGTGGG - Intergenic
918371659 1:183867381-183867403 GCAAAGAAAGGATTTCAGGGAGG + Intronic
919239408 1:194892104-194892126 GTAAGGAAAGAAAAACTTGGGGG + Intergenic
921934457 1:220784069-220784091 GCAAGGAAAGTATTAGAGGGGGG + Exonic
922665746 1:227466954-227466976 GCAAGCAAAGGTTGACATGGTGG + Intergenic
923961833 1:239093697-239093719 GTAAGGAAAGGATGAGGTGAAGG - Intergenic
923975629 1:239258758-239258780 GTAAGGAAACAATTAGATTGGGG + Intergenic
1062861573 10:814514-814536 GAAATAAAAGGACTACATGGTGG + Intronic
1063509676 10:6633574-6633596 GTGATGAAAGGATTACAGGGTGG + Intergenic
1065235196 10:23643536-23643558 CTAAGGAAGTGTTTACATGGAGG + Intergenic
1067657149 10:48203435-48203457 GTAAAGAAAGGATTTCATGCTGG - Intronic
1068021913 10:51595728-51595750 GTCAGAAAAGGTTTACCTGGAGG - Intronic
1070190659 10:74108904-74108926 GAAAGGAAAGAATTCCAGGGGGG + Intronic
1072049151 10:91686507-91686529 GAAAGGCAAGTCTTACATGGCGG + Intergenic
1073050770 10:100665727-100665749 GGAAGGAAAGGGTTAAAGGGAGG - Intergenic
1073571364 10:104583464-104583486 GAAAGGAATGTTTTACATGGTGG - Intergenic
1075302133 10:121334288-121334310 GTAAGGAGAAGAGTAGATGGAGG + Intergenic
1078736676 11:14026663-14026685 TTAAGGAAAGGATAACAGGGAGG + Intronic
1080557076 11:33427552-33427574 GTAAGGAAATTATTTCAAGGGGG - Intergenic
1081406384 11:42703481-42703503 GTAAAGAGGGGATTAGATGGTGG - Intergenic
1082118411 11:48352271-48352293 GGACGGAAAAGAGTACATGGGGG + Intergenic
1082190966 11:49244451-49244473 GTAAGGAAAGGCTTCCCTGAAGG + Intergenic
1082778924 11:57271055-57271077 GTAAGTAGAGTTTTACATGGTGG + Intergenic
1086862340 11:91939646-91939668 GCAAGGAATGCCTTACATGGTGG - Intergenic
1088114338 11:106298505-106298527 GTATGGAGAGTATAACATGGAGG - Intergenic
1088228937 11:107653613-107653635 GTAAGGAAAGGAGGAGAGGGAGG - Intronic
1088545377 11:110953605-110953627 GGAAGGAAGGGGTTACCTGGTGG + Intergenic
1092592826 12:9967075-9967097 GTGATAAAAGGATTACAGGGTGG + Intronic
1096332768 12:50728927-50728949 CTAAAGCAAGGATTACATGGTGG - Intronic
1097355808 12:58600258-58600280 GAAAGGAAAATATTACATGTGGG + Intronic
1097542272 12:60955991-60956013 GTGATAAAAGGATTACAGGGTGG + Intergenic
1098485620 12:71018034-71018056 ATCAGGAAAGTATTAAATGGAGG + Intergenic
1099090498 12:78301116-78301138 GGAACGAAAGGAATACAAGGTGG + Intergenic
1099785997 12:87264678-87264700 GTAGAGAATGGATTATATGGGGG - Intergenic
1100871917 12:98918475-98918497 TTAGGGAAAGGATTAAATTGTGG - Intronic
1102069450 12:110005425-110005447 GTGAGGAAAATATTACAGGGTGG - Intronic
1103092070 12:118104322-118104344 GTAAGGAAAGGAAGCGATGGCGG - Intronic
1107250106 13:38349915-38349937 GTAAGCAAACACTTACATGGTGG - Exonic
1107367600 13:39700902-39700924 GTGAGGAAAGGAGTGCATAGAGG + Intronic
1109225542 13:59690060-59690082 GTGAAGAAAGGATAACATGATGG + Intronic
1109782168 13:67126388-67126410 GAAAGCAAAGCATTACATTGTGG + Intronic
1109910680 13:68906267-68906289 GGGAGGAAAGGAGGACATGGAGG - Intergenic
1111300682 13:86346099-86346121 GTAAGGAAAGGATAAATAGGTGG - Intergenic
1111840121 13:93439460-93439482 GCAAGGAATGTCTTACATGGTGG - Intronic
1113365736 13:109674148-109674170 GCAAGGCAAGTCTTACATGGCGG - Intergenic
1114586049 14:23814856-23814878 GTAAGCAAAGAATGACAAGGAGG + Intergenic
1116959085 14:50951905-50951927 GTAATGAGAAGATGACATGGAGG + Intergenic
1118049752 14:62013992-62014014 GTAAGGAATGCATTTCATGGGGG - Intronic
1119825999 14:77657444-77657466 GTAAGGAAAGGATATGACGGGGG - Intergenic
1119880832 14:78098221-78098243 GAAAGGCAAATATTACATGGTGG + Intergenic
1120618179 14:86733040-86733062 GTGATGAAAGGATTATAGGGTGG - Intergenic
1121869783 14:97396535-97396557 ATAAGGAAAGGATTGCTTAGAGG - Intergenic
1124572711 15:30880504-30880526 GAAAGGAACGTCTTACATGGCGG + Intergenic
1125059833 15:35406216-35406238 GAGAGGGAAGGATAACATGGAGG + Intronic
1125705979 15:41736582-41736604 GTGAGGGAGAGATTACATGGAGG + Exonic
1129700980 15:77768622-77768644 GGGAGGAAAGGAATATATGGGGG + Intronic
1134446133 16:14332935-14332957 TTTAGGACAGGATTACATGGGGG - Intergenic
1134807336 16:17137233-17137255 GTAAGGAAACGAAGGCATGGAGG - Intronic
1135754404 16:25084419-25084441 GTAGGGAACAGATTAAATGGAGG + Intergenic
1137356996 16:47776567-47776589 GGAAGGAAAGGATAGAATGGTGG + Intergenic
1138063051 16:53911485-53911507 GTAAGGACAGGAGGACAAGGTGG + Intronic
1140340371 16:74153131-74153153 GTAAGGGAAGGTTGAGATGGGGG + Intergenic
1141040266 16:80667086-80667108 GTCAGCAAAGGTTTCCATGGGGG + Intronic
1141414908 16:83863215-83863237 GCAAGGAATGTCTTACATGGCGG - Intergenic
1142787105 17:2232911-2232933 GAAAGGAAAAGTTTAGATGGTGG - Intronic
1142941596 17:3384235-3384257 TTAAGGAAGAGATTAAATGGGGG + Intergenic
1144398692 17:14872551-14872573 CTAAGGAAAGGATTTGAAGGCGG - Intergenic
1145271762 17:21408726-21408748 GTGATGAAAGGATGGCATGGTGG - Intronic
1145309976 17:21696190-21696212 GTGATGAAAGGATGGCATGGTGG - Intronic
1147383075 17:40067103-40067125 GGGAGGAAAAGATTACATGACGG - Intronic
1150419504 17:65019327-65019349 GAAAGGAAATGAGTATATGGAGG + Intronic
1155828909 18:30486731-30486753 TTGTGGAAAGGATTACATGATGG + Intergenic
1155892770 18:31288242-31288264 GTAATAAAAGGATTATAGGGTGG + Intergenic
1156093137 18:33495402-33495424 GTAGGAAAAGGATTACAGGAAGG - Intergenic
1157137953 18:45076033-45076055 GTAGGGAAAGAATCAGATGGGGG - Intergenic
1157499773 18:48181489-48181511 GTTCAGAAAGGATAACATGGGGG - Intronic
1158053173 18:53248368-53248390 TTAAGGAAAGGATTACTAGAGGG + Intronic
1159333747 18:67036030-67036052 GTAAGGCATGTCTTACATGGTGG - Intergenic
1161396860 19:4049331-4049353 GTAGGGAAAGGGGTTCATGGCGG - Intronic
1161711135 19:5848782-5848804 GTAATAAAAGGATTATAGGGTGG - Intronic
1163189334 19:15664935-15664957 GGAAGGAGAGAATCACATGGAGG - Intergenic
1164459304 19:28433867-28433889 GTGATAAAAGGATTACAGGGTGG + Intergenic
1165249163 19:34515691-34515713 GTGATGAAAGGATTATAGGGTGG - Intergenic
1166206738 19:41275011-41275033 GTCAGGAAAGGCTTTCTTGGAGG + Intronic
1166516570 19:43451547-43451569 GTAAGGCATGTCTTACATGGCGG - Intergenic
925066843 2:934353-934375 GGAAGGAGAGGAGTCCATGGGGG + Intergenic
925638570 2:5965977-5965999 GAAAGGTATGTATTACATGGTGG + Intergenic
925828895 2:7876638-7876660 GTGATAAAAGGATTACAAGGTGG + Intergenic
926479617 2:13376174-13376196 GAAAGAAAACGTTTACATGGTGG + Intergenic
926596425 2:14794733-14794755 AGAAGGAAAAGATTACATTGGGG - Intergenic
926792419 2:16587793-16587815 GTAAGGGACGTCTTACATGGTGG - Intronic
927584309 2:24285363-24285385 CTAAAGAAAGGACAACATGGTGG - Intronic
929290285 2:40182895-40182917 ATCAGGAAAGGATGAAATGGAGG + Intronic
930840607 2:55841113-55841135 GTAGAGAAAGAATTACCTGGAGG - Intergenic
930969915 2:57382751-57382773 GCAAGGGACGGATCACATGGGGG - Intergenic
932159538 2:69447666-69447688 GTGATAAAAGGATTACAGGGTGG + Intergenic
932392309 2:71405993-71406015 GTAAGAAAATGACTACATGGGGG - Intronic
933032081 2:77341433-77341455 GTAAGGAAAGGCTTACATGAAGG - Intronic
933213028 2:79593583-79593605 CCAAGGACAGGATGACATGGTGG - Intronic
934093452 2:88575727-88575749 GTGAGGACAGGATTCCTTGGTGG + Intronic
939460809 2:142493846-142493868 GTGACAAAAGGATTACAGGGTGG + Intergenic
942340398 2:174938323-174938345 GAAAGTAAAGGATTAAATAGTGG - Intronic
942395460 2:175542874-175542896 GAAAGGCATGTATTACATGGGGG + Intergenic
943865273 2:192919765-192919787 GTGATAAAAGGATTACAGGGTGG - Intergenic
948223181 2:236289451-236289473 GAGAGGAAAGGATAACCTGGGGG + Intergenic
1169472346 20:5897658-5897680 GTAAAAAAAGGATTTCAAGGTGG + Intergenic
1171564710 20:26170720-26170742 GAAAGTAAAGAATTTCATGGAGG + Intergenic
1173038865 20:39441107-39441129 GCAAGGCAAGTCTTACATGGTGG - Intergenic
1173697466 20:45031335-45031357 GGAAGGAAAGGAGTCCATTGTGG + Intronic
1174026464 20:47580569-47580591 ATAAGGAAAGGATTTTTTGGGGG - Intronic
1174771024 20:53300598-53300620 AAAAGAAAAGGATGACATGGAGG - Intronic
1175415533 20:58798282-58798304 GAAGGGAAAGTATTCCATGGAGG - Intergenic
1177130862 21:17253370-17253392 ATAAGGAAAGTATCACATTGTGG - Intergenic
1179456958 21:41506989-41507011 GGAAGGAAAGGATAGCACGGCGG - Intronic
1179524306 21:41965776-41965798 GAAAAGAAAGGATTCCACGGTGG + Intergenic
1182088005 22:27574704-27574726 GGAAGGAAAGGAATACAGGAAGG + Intergenic
1184469880 22:44690396-44690418 GGAGAGAAAGGATTCCATGGTGG + Intronic
949620822 3:5809804-5809826 GTAAGGAGAGGGGTACAGGGAGG + Intergenic
950270216 3:11608662-11608684 GTAATGACAGGATTACAGTGGGG - Intronic
950647276 3:14384594-14384616 GTGGAGAAAGGCTTACATGGTGG - Intergenic
950926421 3:16746050-16746072 GTGATGAAAGGATTATAGGGTGG - Intergenic
952197075 3:31086950-31086972 ATAATGAAAAGATTACTTGGGGG + Intergenic
953608581 3:44428578-44428600 GTCAGGAGAGGATGACTTGGAGG + Intergenic
957442714 3:80271138-80271160 GCAAGGGATGTATTACATGGCGG - Intergenic
957820236 3:85363455-85363477 CTACAGAAAGGATTACTTGGGGG - Intronic
959090480 3:101897425-101897447 GTAAGGCATGTCTTACATGGTGG + Intergenic
959130790 3:102353703-102353725 GAATGAAAAGGATTACGTGGAGG + Intronic
959391848 3:105784989-105785011 GTAGGGAAAAGATTCCATGTGGG - Intronic
961076657 3:123989123-123989145 GTAAGGAGAGAATTTCATGTAGG + Intronic
961082579 3:124038965-124038987 GCCAGGAAAGGAGTCCATGGGGG - Intergenic
962813177 3:138976079-138976101 GTAAGGAGGGGATTGAATGGGGG - Intergenic
963030613 3:140971283-140971305 GTAAGGAAAGTATTACCTTTTGG - Intronic
964620345 3:158714964-158714986 GGAAGGAAAGGATTCCTTGGTGG + Intronic
965397617 3:168178371-168178393 TTAAGTAAAGGATTACAAGTTGG - Intergenic
966363634 3:179157125-179157147 GAAAGGAAAGAATTACATTTTGG + Intronic
969540472 4:7785465-7785487 GGAAGGAAATGATGACATAGAGG - Intronic
970851013 4:20603157-20603179 GAAAGGAATGTCTTACATGGTGG + Intronic
971604007 4:28633589-28633611 CTAAGAAAAGGATTACAGAGAGG - Intergenic
972132187 4:35851578-35851600 GTAAGGAAAAGATGAAATTGAGG + Intergenic
973319046 4:48791250-48791272 GAAAGGCAAGTCTTACATGGCGG - Intergenic
976844147 4:89467930-89467952 ATAAGTATAGGATTAAATGGTGG - Intergenic
978148211 4:105402721-105402743 GTAAAGAAAAGACTACATAGAGG + Intronic
979182734 4:117752229-117752251 AAAAGGCAAGTATTACATGGTGG - Intergenic
979492006 4:121338897-121338919 GTAAGGAAAGGATTACATGGAGG - Intronic
980472519 4:133267700-133267722 GTGATAAAAGGATTACAGGGTGG + Intergenic
980899656 4:138892665-138892687 GTAAGAAATGCATTATATGGGGG - Intergenic
981040170 4:140215223-140215245 GTAATAAAAGGATTATAGGGTGG - Intergenic
982497184 4:156107448-156107470 GTAATAAAAGGATTATAGGGTGG + Intergenic
983549037 4:168995599-168995621 GAAATGAAAGGATGATATGGGGG - Intronic
985389948 4:189483444-189483466 GTGATAAAAGGATTACAGGGTGG + Intergenic
986660349 5:10053912-10053934 GTAAAGAATGTCTTACATGGCGG + Intergenic
987607328 5:20154039-20154061 GGAATGAGAGGATTAAATGGTGG - Intronic
987902525 5:24031328-24031350 GAAAGGAATGGATTCCTTGGGGG + Intronic
988002969 5:25372983-25373005 GAAAGGAAATCAGTACATGGAGG + Intergenic
988399303 5:30741345-30741367 GTAGGGAAAGGATAGAATGGAGG - Intergenic
988558779 5:32261496-32261518 GTCAGGAAGGTTTTACATGGTGG - Intronic
990219314 5:53570175-53570197 GTCAGGGAAGGATAACATGAGGG - Intronic
990328264 5:54699247-54699269 TTAAGGAAAGGAATACCAGGAGG + Intergenic
991334871 5:65535893-65535915 GAAAAGGAAGGATTACAGGGCGG + Intronic
991367719 5:65886574-65886596 GTAATGAAAGGAATAAATGCAGG + Intergenic
992712217 5:79470919-79470941 CTAAGGAAAAAAATACATGGAGG + Intronic
992734921 5:79709388-79709410 GTAAAGAAAGTGTTACATGATGG + Intronic
993543526 5:89182484-89182506 GTAAGGAATGGAATACAAGCAGG - Intergenic
995914868 5:117232905-117232927 GAAAGGAAAGGATAGCAAGGAGG + Intergenic
997284534 5:132668666-132668688 GTCAGGAAAGGATTTCATGCAGG - Intergenic
997841268 5:137242403-137242425 GAAAGGCAAGTCTTACATGGTGG - Intronic
998577231 5:143329189-143329211 GCAAGGAAAGTCTTACATGGTGG + Intronic
999068728 5:148719390-148719412 GTGAGGAAGGGATTACTAGGTGG + Intergenic
999618942 5:153453691-153453713 GTGATGAAAAGATTACAGGGTGG + Intergenic
1000105731 5:158057190-158057212 GCAAGGAAAGGCTTCCCTGGGGG - Intergenic
1001320452 5:170676212-170676234 GAAAGGAAAGGATTACAGGTGGG + Intronic
1001898882 5:175405959-175405981 GTAATGAAACTATTACATGCTGG + Intergenic
1003789483 6:9527552-9527574 GTAAGAAATTGATTACATTGGGG + Intergenic
1005244727 6:23869898-23869920 GTTAAGAAAGGATTAGATGTGGG + Intergenic
1005249238 6:23925893-23925915 TTAAGGAAAGGCTTACAAGATGG - Intergenic
1005392225 6:25345215-25345237 GTAAAGAATGTATTTCATGGAGG - Intronic
1006094492 6:31647491-31647513 GGAGGGAAAGGATTACTTGGAGG - Intronic
1006270010 6:32957150-32957172 GGTGGGGAAGGATTACATGGAGG - Intronic
1008075937 6:47146413-47146435 GCTAGGAAAGTATTAAATGGAGG - Intergenic
1008252389 6:49256095-49256117 GTAAGGAAAGGAATAGTTGTGGG - Intergenic
1008722265 6:54370320-54370342 GAAAAGAAAAGATTACATGAAGG + Intronic
1009640523 6:66329425-66329447 GTAAAGAATTGATTACAGGGAGG + Intergenic
1009823187 6:68831133-68831155 GTAGGGAAAGGAATACAAGAAGG + Intronic
1010071798 6:71752560-71752582 GTAATAAAAGGATTATAGGGTGG + Intergenic
1011366576 6:86588699-86588721 GTAAGAAAAGAATCACATGGAGG + Intergenic
1012427418 6:99129686-99129708 GTAAGGAAAGGAGAAAATGTTGG - Intergenic
1012471304 6:99575670-99575692 GAAAGGAAAGGATGACATTTAGG - Intergenic
1012948820 6:105495928-105495950 TTAAGGGAAGGATTATATGAAGG - Intergenic
1013804703 6:113984344-113984366 GAAAGGGAAGGATTACAAAGAGG + Intronic
1014019065 6:116567019-116567041 GCAAGGCACGTATTACATGGTGG + Intergenic
1014250333 6:119109089-119109111 GTTGGGAAAGGGTTTCATGGAGG - Intronic
1014682176 6:124445220-124445242 CTAAGGAAAGGATTAGAAGGTGG + Intronic
1016143764 6:140644915-140644937 GTAAGGCATGTCTTACATGGTGG + Intergenic
1016193885 6:141307809-141307831 GAAAGGCAAGTGTTACATGGTGG - Intergenic
1017185079 6:151592490-151592512 GTAAGGGATGTCTTACATGGTGG + Intronic
1019766335 7:2853758-2853780 GTAAGGGATGTCTTACATGGTGG - Intergenic
1021026894 7:15679302-15679324 GCAAGGAAAGGATAAAAGGGAGG - Intronic
1022308809 7:29175537-29175559 GCAAGGAATGTCTTACATGGCGG - Intronic
1024028404 7:45433604-45433626 GTAAGTAAGGGAATAGATGGGGG - Intergenic
1024970229 7:55062410-55062432 GTTAAGAAAGGGGTACATGGGGG - Intronic
1026135777 7:67659447-67659469 GCAAGGAAAAGATCACTTGGGGG - Intergenic
1026295230 7:69046145-69046167 ATGAGGAAAGAATGACATGGGGG + Intergenic
1028249243 7:88521407-88521429 GGAAGGAGAGGATGAGATGGTGG + Intergenic
1031304552 7:120110228-120110250 GGAAGGAATGCATTACTTGGGGG + Intergenic
1031459958 7:122036901-122036923 GTGAGGAAAGGAATTCATGATGG + Intronic
1031539236 7:122973179-122973201 TTAAGGAAAGGCATACATTGTGG - Intergenic
1031722943 7:125200267-125200289 GAAAAGAAAGGAATAGATGGAGG - Intergenic
1032258681 7:130317023-130317045 GGATGGAAAGGATGAGATGGAGG + Intronic
1032739586 7:134725211-134725233 TTAAGGAAAGGCTTACTTTGAGG - Intergenic
1034857791 7:154569097-154569119 GTAATAAAAGGATTACATATGGG + Intronic
1037165668 8:15825345-15825367 GTAAGGCACGTCTTACATGGTGG + Intergenic
1041486676 8:58385127-58385149 GAAAGGAAAGGATTAATAGGGGG - Intergenic
1041698192 8:60759691-60759713 GTAAGAAGAGGCTTACATGGTGG - Intronic
1041917875 8:63154127-63154149 GTAAGGGAAGGAGTATAAGGAGG + Intergenic
1043717976 8:83509125-83509147 GTGATAAAAGGATTACAGGGTGG + Intergenic
1044023341 8:87135381-87135403 GCAAGGAAAAGATTACTTTGAGG - Intronic
1046045633 8:108960988-108961010 GTAAGGAACAGACAACATGGTGG - Intergenic
1046511097 8:115203791-115203813 GTGAGGAAAGGAATTTATGGAGG - Intergenic
1046622910 8:116546830-116546852 GCAAGGAATGTCTTACATGGCGG + Intergenic
1047569544 8:126083077-126083099 ATAATGGAAGTATTACATGGTGG - Intergenic
1047774435 8:128057862-128057884 GAAAAGAAAGGCTCACATGGTGG + Intergenic
1047983372 8:130206812-130206834 GTCAGGAAAGGAATAACTGGTGG - Intronic
1048916789 8:139191974-139191996 GAAATGAAAGGAATAGATGGGGG - Intergenic
1049217253 8:141413869-141413891 GTATGGACAGGAGGACATGGAGG + Intronic
1050099277 9:2100926-2100948 GAAAGGAACGTCTTACATGGTGG + Intronic
1050117521 9:2277286-2277308 GTGATGAACGGATTACAGGGTGG - Intergenic
1050582959 9:7080241-7080263 GTAAGGAGGAGAATACATGGGGG - Intergenic
1052238676 9:26246031-26246053 GAGAGGAAAGGATAACTTGGTGG - Intergenic
1055089294 9:72346520-72346542 GAAAGCAAAGGAGTAGATGGTGG - Intergenic
1056167617 9:83954287-83954309 ATAAGGAGAACATTACATGGAGG + Intronic
1057263140 9:93597454-93597476 GTCAGGAAAGGAGAGCATGGTGG + Intronic
1057820776 9:98328957-98328979 GTAATGATAAGGTTACATGGTGG - Intronic
1058203297 9:102070256-102070278 TTCAGGAATGGCTTACATGGTGG - Intergenic
1058525406 9:105852567-105852589 GTAAGGCACGTCTTACATGGTGG + Intergenic
1058955945 9:109948771-109948793 GAAAGAAAAGAATTACAGGGTGG + Intronic
1058987717 9:110224335-110224357 CAAAGGGAAGGCTTACATGGTGG - Intergenic
1059509176 9:114828026-114828048 GTAAGGCATGGCTTCCATGGGGG - Intergenic
1060598756 9:124863915-124863937 CTAAGGAAAGGATTGCACAGAGG - Intronic
1061020790 9:128013246-128013268 GTAAGGAAAGGAGAATAGGGAGG + Intergenic
1061023273 9:128030820-128030842 GGAAGGAAAGGATTACCAAGGGG - Intergenic
1062066767 9:134532434-134532456 GGAAGGACACGAGTACATGGAGG + Intergenic
1186353169 X:8760901-8760923 GACAGGAAAGGATTAATTGGTGG - Intergenic
1188463455 X:30453081-30453103 GTGATAAAAGGATTACAGGGGGG + Intergenic
1189696101 X:43664517-43664539 ACAAGGAAAGGATTTCATGGAGG + Intronic
1190566812 X:51738798-51738820 GTAAGGCAAGCATAACTTGGAGG - Intergenic
1191041426 X:56084982-56085004 GTAAGCAAAGGAGTTCCTGGGGG + Intergenic
1192240973 X:69328080-69328102 GTAAGGCATGTCTTACATGGAGG - Intergenic
1192925561 X:75751502-75751524 GTGAGGAAAGTATTACAAGGAGG - Intergenic
1195313365 X:103655299-103655321 GAAAGGCATGTATTACATGGCGG + Intergenic
1195481930 X:105355099-105355121 GTAAAAAATGGATTGCATGGTGG - Intronic
1195979977 X:110567269-110567291 AAAAGTAAAGAATTACATGGGGG + Intergenic
1196003861 X:110814629-110814651 GTGAAGAAAGTATTATATGGAGG + Intergenic
1198377239 X:136052226-136052248 GTATGAAAAGCATTACAAGGGGG + Intergenic
1198965839 X:142228241-142228263 GTAATAAAAGGATTATAGGGTGG - Intergenic
1199452370 X:147991022-147991044 GTAAAGAAAGGCTTTCATGAGGG - Intronic
1200532915 Y:4359376-4359398 GTAATAAAAAGATTACAGGGTGG + Intergenic
1201581315 Y:15514097-15514119 GTAATAAAAGGATTACAGGGTGG - Intergenic
1201724890 Y:17140687-17140709 GTGATGAAAGGATTATAGGGTGG + Intergenic