ID: 979492007

View in Genome Browser
Species Human (GRCh38)
Location 4:121338900-121338922
Sequence CAAGTAAGGAAAGGATTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492007_979492011 5 Left 979492007 4:121338900-121338922 CCATGTAATCCTTTCCTTACTTG 0: 1
1: 0
2: 3
3: 23
4: 298
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492007_979492015 19 Left 979492007 4:121338900-121338922 CCATGTAATCCTTTCCTTACTTG 0: 1
1: 0
2: 3
3: 23
4: 298
Right 979492015 4:121338942-121338964 GTTTTCAGGAGTTCTGATGTTGG 0: 1
1: 0
2: 2
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492007 Original CRISPR CAAGTAAGGAAAGGATTACA TGG (reversed) Intronic
900813466 1:4825794-4825816 CAAGAAAGTAAAGGAATAAAAGG - Intergenic
904451714 1:30617144-30617166 CAAGGAAGGAAATGGTTGCAGGG + Intergenic
907490340 1:54805375-54805397 CAAGTAAAGAAAGGAATTGAGGG - Intergenic
908277796 1:62493997-62494019 AAAGTATGTAACGGATTACAAGG + Intronic
909064252 1:70914826-70914848 AAAGTAAGGTAATGATCACAGGG + Intronic
910958747 1:92737760-92737782 CATGTACGGAAAGGATAAAATGG + Intronic
911784565 1:101930085-101930107 TAACAAAGGAAAGGATTAAACGG - Intronic
913672353 1:121109397-121109419 CAAGTAAAGAAAGTTTTCCAAGG + Intergenic
914024120 1:143896761-143896783 CAAGTAAAGAAAGTTTTCCAAGG + Intergenic
914662607 1:149804790-149804812 CAAGTAAAGAAAGTTTTCCAAGG + Intronic
915031669 1:152885056-152885078 CAAGTAAGTAAAGGAACAAACGG - Intergenic
916310932 1:163398152-163398174 CAAGTAAGGGACGGATTGGAAGG + Intergenic
916493750 1:165326490-165326512 CAAGTGGGGAAAGGATCACAGGG + Intronic
917176034 1:172236577-172236599 CAAGTGAGGAAAGGAGGAGAAGG + Intronic
917752757 1:178068583-178068605 CAATTAAGAAAAGGATATCAGGG + Intergenic
918371658 1:183867378-183867400 CAAGCAAAGAAAGGATTTCAGGG + Intronic
919572939 1:199270969-199270991 GAAGTAAGGAATGGCTTACATGG + Intergenic
920989486 1:210922972-210922994 CAAGTAAGGAAAAAATGGCAAGG - Intronic
922846607 1:228690231-228690253 GAAGTAAGGAAAGGAAGAAAAGG + Intergenic
922927914 1:229365820-229365842 GAAGCAAGGAAAGTCTTACATGG - Intergenic
923458605 1:234187764-234187786 CAAGTCAGAAATGGCTTACATGG - Intronic
923984827 1:239369677-239369699 AAAGGAAGTAAAGGAATACAGGG - Intergenic
924252755 1:242151614-242151636 CAAGTAAGGAAACAAATACTAGG - Intronic
1062918731 10:1263680-1263702 CAAGTAAGGAAATGGGTAGATGG - Intronic
1063502841 10:6570490-6570512 CAAGAAAGAAATGGATTCCAGGG + Intronic
1063509675 10:6633571-6633593 GAGGTGATGAAAGGATTACAGGG + Intergenic
1063721100 10:8582373-8582395 CTAGTGAGTAAAGGATTAGATGG + Intergenic
1068309443 10:55259393-55259415 TAAGTAAAGAAAGTATTTCAAGG + Intronic
1069116687 10:64515937-64515959 CCAGTCAGGAAAGGATCAGAGGG + Intergenic
1069339676 10:67395841-67395863 CAAGAAAGTAGAGGATTTCAGGG + Intronic
1069666160 10:70161291-70161313 CAACAAAGAAAAGGAATACAAGG + Intronic
1070190656 10:74108901-74108923 GAAGAAAGGAAAGAATTCCAGGG + Intronic
1070645407 10:78198691-78198713 CAACTAAGGTAAGGATCTCAAGG + Intergenic
1071665462 10:87551595-87551617 CAAGTCTGAACAGGATTACATGG - Intronic
1073599126 10:104829781-104829803 CGAGTGAGGAAAGCATTTCAAGG - Intronic
1074229805 10:111522689-111522711 ATAATAAGGAAGGGATTACATGG + Intergenic
1074884174 10:117681980-117682002 CAAGGAATGAAAGCATTAGAAGG + Intergenic
1075592335 10:123701993-123702015 CAAGTGAGGAATAGATTATAGGG - Intergenic
1077106793 11:845720-845742 CAGTGCAGGAAAGGATTACAGGG + Intronic
1079745071 11:24116356-24116378 TAAGTAAAAAAAGGAGTACAAGG + Intergenic
1080417102 11:32078991-32079013 CAATTAAGGAAAGTTTCACAGGG - Intronic
1080975877 11:37339822-37339844 AAAGCAAGAAAAGGAATACAAGG - Intergenic
1081052914 11:38367544-38367566 CAAGAAAGCAAGGGATTTCAAGG - Intergenic
1082228419 11:49735765-49735787 GAAGTCATGAAAAGATTACAAGG - Intergenic
1086397896 11:86434895-86434917 CAAATATGGACAGAATTACAAGG + Intergenic
1086561356 11:88173373-88173395 CAAGTAAGGAAACCAAAACAAGG + Intronic
1086621649 11:88893387-88893409 GAAGTCATGAAAAGATTACAAGG + Intronic
1087489954 11:98812581-98812603 CAACCAAGAAAAGGACTACATGG + Intergenic
1088832038 11:113545463-113545485 CAAGTAAGTAAATGAATCCAGGG - Intergenic
1089577883 11:119459662-119459684 GAAGTCAGAAAAGGAATACAGGG + Intergenic
1094685607 12:32711149-32711171 CAAGTAAAGAAAGTGTTTCAAGG - Intronic
1094738994 12:33267077-33267099 CAATGAGAGAAAGGATTACAAGG - Intergenic
1095171325 12:39039252-39039274 AAATTAAGGAAAGCATGACAGGG - Intergenic
1095266548 12:40165783-40165805 AAAGTAATGAAATGATTAGAAGG - Intergenic
1095334385 12:41008687-41008709 GAAGTCATGAAAGGATTAGAAGG - Intronic
1095497864 12:42804233-42804255 GCATTAAGGAAAGGAATACATGG - Intergenic
1095904396 12:47362622-47362644 CAACAAAGGAAAAGATCACAGGG + Intergenic
1096070724 12:48774130-48774152 CAAGGAGGGAAAGGGTTGCAAGG + Intronic
1096760009 12:53833566-53833588 CAAGCAAGGAAAAGAGAACAAGG + Intergenic
1096767721 12:53907132-53907154 CAAGAGAGGAAATTATTACATGG + Intergenic
1097394645 12:59059017-59059039 TAAGTAAGGAAAGAATTATATGG - Intergenic
1097769892 12:63571690-63571712 CAAGTAATGAAATGATTTCATGG - Intronic
1099775505 12:87122762-87122784 CAACTAAGGAAAGTGTTTCAAGG + Intergenic
1100699164 12:97128114-97128136 GAAGTAAGGAGAGCATTCCAGGG + Intergenic
1101668695 12:106845929-106845951 CAAGTGAAGAAAGTATTTCAAGG - Intronic
1104214076 12:126718785-126718807 CGAGAAAGGGAAGGATTAGAGGG + Intergenic
1104658833 12:130594122-130594144 GAAGTGAGGAAAGGAAGACAAGG - Intronic
1104916084 12:132265302-132265324 CACGGAAGGAAAGGCTTCCACGG - Intronic
1105238474 13:18585665-18585687 CAACTAAGCAGAAGATTACAAGG - Intergenic
1105566699 13:21556287-21556309 TAAGTAAAGAAAGCATTTCAAGG - Intronic
1106508499 13:30392593-30392615 CCAGTATGGAAAGGAACACAAGG + Intergenic
1106582200 13:31028003-31028025 CAAGTCAGGAGAGGATTGGAAGG - Intergenic
1107122263 13:36808664-36808686 CAAAAAAGGAAAGAAATACATGG - Intergenic
1108473294 13:50788638-50788660 CAAGAAATGAAAATATTACAAGG + Intronic
1108835152 13:54536261-54536283 CAAATAAGGAAACCATGACATGG - Intergenic
1109130464 13:58578192-58578214 AAAGTAAGAGAAGGATTAAAGGG - Intergenic
1109183740 13:59245604-59245626 CAAGTGAAGAAAGTATTTCAAGG + Intergenic
1109764022 13:66869786-66869808 AAAGTAAGAAAAGGGTGACAGGG - Intronic
1109963127 13:69658160-69658182 CAATTAAGAAAATGGTTACATGG + Intergenic
1109969952 13:69754974-69754996 CAAGTAAGCAAAGTATTGCAGGG - Intronic
1111181011 13:84665093-84665115 AAAATAAGGAAAGGATAACAAGG + Intergenic
1111689974 13:91551400-91551422 CAAGTAAGGTAAAGAAGACAGGG + Intronic
1111840566 13:93444783-93444805 AAAGTAGGAAAAGGATTAAAAGG - Intronic
1112848316 13:103671846-103671868 CAAGTGAAGAAAGCATTTCAGGG - Intergenic
1113146588 13:107214896-107214918 CAAATAAGGAAACGTATACAGGG + Intronic
1114654746 14:24309540-24309562 CAAGAAAGGAAAGGATGAGTAGG - Intronic
1115375827 14:32674171-32674193 GAAATAAGGCAAGGATGACAGGG + Intronic
1116090507 14:40298543-40298565 CAAATAAGAAAAGTAATACAGGG + Intergenic
1118049755 14:62013995-62014017 CAGGTAAGGAATGCATTTCATGG - Intronic
1120343382 14:83250979-83251001 CAAGTTAAGAAAGAATTACTGGG - Intergenic
1120532546 14:85649959-85649981 AAAGTAAAGAAAGTAATACAAGG + Exonic
1126198696 15:45960555-45960577 CAAGTCAGGAAAGGCTTCTAAGG - Intergenic
1127747676 15:61997206-61997228 CAAGTGAAGAAAGAATTTCAAGG - Intronic
1128567965 15:68713796-68713818 CAAATAAGGAAATAATTGCAGGG + Intronic
1129414808 15:75369649-75369671 CAGGTCAGGATAGGATTTCAAGG - Exonic
1130166217 15:81461598-81461620 GAAGTAAGGAGAGGATTTGAGGG - Intergenic
1131039918 15:89254821-89254843 AAAGTAAGTAAATGAATACATGG + Intronic
1131466419 15:92658259-92658281 TAAGTAAGCAAATGATTAGAAGG - Intronic
1134247531 16:12551074-12551096 CAAGCAAAGAGAGGATCACATGG - Intronic
1134600453 16:15529485-15529507 CTTCTAAGGAAAGGATTGCAGGG - Intronic
1135081214 16:19437709-19437731 CCAGTAGGGAAAGGATGAGAAGG - Intronic
1139210820 16:65075075-65075097 CATGGAAGGAAAGGCTTGCATGG + Intronic
1139780710 16:69349191-69349213 CAATTAACAAATGGATTACAGGG - Intronic
1139937895 16:70584370-70584392 CCAGTATGGAAAGGATGCCAAGG - Intronic
1142915131 17:3130299-3130321 CAAGAAAGGAAAGGAATAATTGG + Intergenic
1143551021 17:7630577-7630599 CAGATAAGGAAAGGAAGACAGGG - Intronic
1144398693 17:14872554-14872576 CAGCTAAGGAAAGGATTTGAAGG - Intergenic
1146464608 17:33076283-33076305 CCACTAAGGAAGGTATTACAGGG + Intronic
1148472411 17:47903354-47903376 CAAGTAAAGAAAGTGTTTCAAGG + Intronic
1149062433 17:52438660-52438682 CAAGTGAAGAAAGAATTTCAAGG - Intergenic
1149345022 17:55726013-55726035 CAGGTAATAAAAGGAGTACAAGG + Intronic
1149399903 17:56285383-56285405 CAAATAAGAAAAGGAGTAGAAGG - Intronic
1149763717 17:59256399-59256421 CAAGTAATGAAAAAATTAGAAGG - Intronic
1151066475 17:71156439-71156461 TAAGTAAGGTCAGTATTACAAGG - Intergenic
1153682569 18:7514417-7514439 CAAGGAAGAAGAGGATTTCAAGG + Intergenic
1157258538 18:46159030-46159052 AAAGTAAGAAAAGGGTTCCAGGG + Intergenic
1158511657 18:58095682-58095704 AAACTATGGAAATGATTACAGGG - Intronic
1159335299 18:67056491-67056513 CAAGTCATTAAAGGATTTCAAGG - Intergenic
1163010279 19:14420923-14420945 CAAGTAAAGAAAGGATCAGCGGG + Intergenic
1165662327 19:37592571-37592593 AAAAAAAGGAAAGGATTAAATGG + Intronic
1166176498 19:41075468-41075490 CATTTTAGGCAAGGATTACAAGG - Intergenic
1166369095 19:42291520-42291542 CAAGAAAGGAAAAGGTTACAAGG - Intronic
1166515384 19:43442929-43442951 GAAGTGAGGAAAAGATTAAAGGG + Intergenic
1167247728 19:48383799-48383821 CAAGTAAAGAAAGAATTAGTTGG - Intronic
1167796245 19:51711100-51711122 CAAGTAAAGAAAGCGTTTCAAGG + Intergenic
926317998 2:11725520-11725542 CAAGTCAGGAAAGGGTTAGGGGG - Intronic
926585263 2:14679018-14679040 CAAGTGAGGAAATGAAGACAGGG + Intergenic
927025472 2:19064407-19064429 TAAATAAGGAAAGTATTGCATGG + Intergenic
927177919 2:20423203-20423225 CAAGCAAGGAAAGGAGGGCAGGG - Intergenic
927233848 2:20851765-20851787 AATGTAATCAAAGGATTACAGGG - Intergenic
932732328 2:74230216-74230238 CAAGAAAGGAAAGTCTTACGTGG + Intronic
933012170 2:77080186-77080208 CAAGTACAGAAAGAATTTCAAGG - Intronic
933459355 2:82561619-82561641 CAAGTAAGGAATTGATTACGGGG - Intergenic
934105261 2:88689575-88689597 AACCTAAGGAAAGGATTAAAAGG + Intergenic
934786028 2:97007037-97007059 CAAGATTGGAAATGATTACAAGG - Intronic
935602428 2:104936716-104936738 GAAGGAAGGAAATCATTACAGGG - Intergenic
936650057 2:114415604-114415626 CAAGTAATGAAATGATCACCAGG - Intergenic
936749249 2:115621074-115621096 TAAGTATGGAAAGAATTTCATGG - Intronic
937042450 2:118833136-118833158 CAAGCACGGAAAAGGTTACAGGG + Intergenic
938511437 2:131950276-131950298 CAACTAAGCAGAAGATTACAAGG - Intergenic
938625868 2:133108524-133108546 TATGTAAGGAAAGGCTAACAGGG - Intronic
939621463 2:144424302-144424324 CAAGTAAAGAAAGGATTAAAAGG + Intronic
940461593 2:153970332-153970354 CAAGTAACAAAAGCAATACAAGG - Intronic
940510839 2:154612635-154612657 AAAGTAAGGAAGGGATTTCTTGG + Intergenic
941032133 2:160524662-160524684 CAAGTAAGGAGAGTATTAGAAGG + Intergenic
942333139 2:174850556-174850578 CAATAAATGACAGGATTACAGGG + Intronic
942376664 2:175344316-175344338 CAAGGAAGGAGAGGAAAACAGGG - Intergenic
943289578 2:186051695-186051717 AAATTAAGGAAAGGACCACATGG - Intergenic
944709666 2:202324417-202324439 TAAGTGAGGAACGGATTGCAGGG - Intergenic
945954466 2:216073103-216073125 AAAGTTAGGCAAGGCTTACAAGG - Intronic
947442832 2:230138218-230138240 CAAGGCAGCAAAGGCTTACAGGG + Intergenic
947475633 2:230445634-230445656 CAAGTCAGAAAAGGAATAAAAGG + Intronic
1169025878 20:2370879-2370901 CAAGGAAGGAAAAGATGAAATGG - Intergenic
1169190280 20:3654578-3654600 CGTGGAAGGAAAGGCTTACAGGG - Intergenic
1169472345 20:5897655-5897677 TAAGTAAAAAAAGGATTTCAAGG + Intergenic
1172049223 20:32103553-32103575 CAAGTTAGTATAGGATTCCATGG - Intergenic
1172587861 20:36097333-36097355 CAAGTAAGGAAATGAGGAAATGG - Intronic
1174113758 20:48213484-48213506 AGAGAAAGGAATGGATTACAGGG - Intergenic
1175785143 20:61707502-61707524 CTAGGCAGGTAAGGATTACACGG - Intronic
1176782460 21:13213946-13213968 CAACTAAGCAGAAGATTACAAGG - Intergenic
1177083425 21:16671306-16671328 CAAGTAAAGAAAAGATTTAAAGG - Intergenic
1177598234 21:23275165-23275187 CAAGTAAGGATTTGAGTACAAGG - Intergenic
1177866262 21:26516767-26516789 CAAGTAATGAAAGGATTCTAGGG + Intronic
1177980040 21:27901657-27901679 CAACTAAGCAGAAGATTACAAGG + Intergenic
1178553442 21:33563157-33563179 CTAGGAAGGAAAGAATAACAAGG - Intronic
1181446673 22:22981746-22981768 GAAGTAATGAAAGGATTAAAAGG + Intergenic
1181998735 22:26903382-26903404 CAAATAAGGGAGCGATTACACGG + Intergenic
1183216098 22:36481208-36481230 CGAGTAAGGGAAGGAATACGAGG + Intronic
1183842656 22:40513035-40513057 GAAGAAAGGAAAGTTTTACAAGG + Intronic
1184801159 22:46760944-46760966 CAGCTAAGCAAAGGATTACTAGG - Intergenic
1185200161 22:49497325-49497347 TAAGAACTGAAAGGATTACAGGG + Intronic
949774429 3:7615807-7615829 CAAGACAGAAAAGAATTACAGGG - Intronic
951786212 3:26422057-26422079 CATGTGAGGAATGGATTAAATGG + Intergenic
952223585 3:31350705-31350727 TAAGTATTCAAAGGATTACAAGG + Intergenic
952583936 3:34868589-34868611 CAAGAAAGGAAAGAGTTTCAGGG - Intergenic
952604044 3:35122782-35122804 CAAGTAAGAAAAGGATTGAAAGG - Intergenic
952936592 3:38403396-38403418 CAAGTATGCAAAGGTATACATGG + Intronic
956318784 3:67971343-67971365 CAAGGGAGGAAAGGAATACTTGG - Intergenic
956324294 3:68034223-68034245 CAAGTAAAGGAAGCATTCCAGGG - Intronic
957810292 3:85213915-85213937 CAAATATTGAAATGATTACAAGG - Intronic
957996207 3:87692842-87692864 TAACTAAGGAAAAGAGTACATGG - Intergenic
959309117 3:104709160-104709182 TAAATAAGGTAAGGATGACAAGG + Intergenic
959368804 3:105496937-105496959 CAAATATGGAAAGAATTAAATGG + Intronic
959792266 3:110376020-110376042 CAAGTAAAGAAAGTGTTTCAAGG + Intergenic
959857194 3:111173566-111173588 GAAGAAAGGAATGTATTACAGGG - Intronic
962988073 3:140553843-140553865 CCAGGAAGGAAAGGAGAACAGGG + Intronic
963180581 3:142351333-142351355 CAAGTGAAGAATGGATGACAAGG + Intronic
964157593 3:153604626-153604648 GAGGTAAGGAAAGGAGTACACGG - Intergenic
964160052 3:153635981-153636003 TAAGTAAAGAAAGGATTGCCAGG + Intergenic
965780754 3:172283446-172283468 CAAGGAAGGGAAGAATTAAAGGG - Intronic
968934472 4:3602827-3602849 CAAGTAAGGAAAGGGGAATAGGG - Intergenic
970064533 4:12077170-12077192 CAAGTAGTGAAAGGGGTACAAGG - Intergenic
970222884 4:13828386-13828408 CTTGTAAGGCAAGGATTAGATGG - Intergenic
970865744 4:20756735-20756757 CCAGTAAGGTAAGGATCAGAAGG - Intronic
971650724 4:29269849-29269871 CAGGTAAGGAAAGCTTTTCATGG + Intergenic
971761328 4:30769858-30769880 AAAGTCAGGGATGGATTACAAGG + Intronic
972041132 4:34601305-34601327 AAAGTAAGGAAAGGAGCACAGGG - Intergenic
972951450 4:44328871-44328893 CAGCTAAGGACAGGAGTACAAGG + Intronic
973164549 4:47060437-47060459 CAAGTACAGAAATGTTTACAGGG - Intronic
973652414 4:53009309-53009331 TAAATAAACAAAGGATTACATGG + Intronic
973700028 4:53527857-53527879 CAAATAAGGGAAGAATTACAGGG + Intronic
975256175 4:72237400-72237422 CAAGGAAGGTAAAGATTAGAGGG + Intergenic
975290164 4:72668677-72668699 AAAGTAAAGAAAGGAAAACAAGG - Intergenic
975678280 4:76849894-76849916 CCAGTTAGGATAGGGTTACATGG - Intergenic
976060237 4:81119378-81119400 CAAATAAGCAAAGCAATACATGG - Intronic
977437731 4:97021127-97021149 CAAGTAAGAAATAGATTATAAGG - Intergenic
977848471 4:101794570-101794592 CAGGAAAGGAAAGGATTACAAGG - Intronic
978260293 4:106748448-106748470 TCAGAAAGGAAAGTATTACAGGG + Intergenic
978611948 4:110551529-110551551 CAAATAAGAAAGGGATTCCAAGG - Intronic
978631776 4:110755787-110755809 CAAGTGAGGAAAAGTTGACAAGG - Intergenic
979492007 4:121338900-121338922 CAAGTAAGGAAAGGATTACATGG - Intronic
980313028 4:131159911-131159933 CAAGTAAGGATATATTTACAGGG + Intergenic
981646258 4:147002062-147002084 CAGGGAAGGAAAGTATTATAGGG + Intergenic
982572844 4:157072652-157072674 CAAGAAAGAAATGGATAACAGGG + Intergenic
985311774 4:188609413-188609435 AAAGAAAGGAAAGGATTGAAGGG + Intergenic
986666854 5:10112161-10112183 CAATAAAGGAAATGATTCCATGG + Intergenic
986972005 5:13347770-13347792 CAAAAGATGAAAGGATTACATGG + Intergenic
988152810 5:27408350-27408372 AAAGTAAGAAAATGATTACAAGG + Intergenic
988950335 5:36251577-36251599 CTAATAAGGAAGGAATTACATGG + Intronic
990328263 5:54699244-54699266 CAATTAAGGAAAGGAATACCAGG + Intergenic
990349261 5:54899529-54899551 CAAGAAAGGAAAGGATTTCAAGG - Intergenic
990374633 5:55156934-55156956 CAAGAAACGGAAGGATTACAAGG - Intronic
991588061 5:68219616-68219638 CAGGTAAGGAGAGAACTACATGG + Intronic
993342266 5:86739065-86739087 CACCTAAGGAAAGGAATAGAGGG - Intergenic
994604469 5:101949966-101949988 GAAGTAAGGAAAGGAGGTCAGGG - Intergenic
995846523 5:116499758-116499780 CAAGGAAGGAAAGGAAAAGAAGG - Intronic
996207259 5:120756264-120756286 CAAGTAACAAAAGGATCAGAGGG - Intergenic
996332539 5:122346185-122346207 CAAGTAAGAAAATCATTAGAGGG - Intronic
996750837 5:126887023-126887045 AAAGTAAGGAGACTATTACATGG - Intronic
997169582 5:131702783-131702805 CAAGTACAGAAAGTATTTCAAGG - Intronic
997751665 5:136352258-136352280 CATGGAAAGAAAGGATGACAAGG - Intronic
998577230 5:143329186-143329208 GAAGCAAGGAAAGTCTTACATGG + Intronic
998862721 5:146459825-146459847 CAGGTAAGGAAAGGATTTTCAGG + Intronic
1001349109 5:170939312-170939334 GAAGGAAGAAAAGGAGTACATGG + Intronic
1003765902 6:9236193-9236215 CAACTAAGGAAAGCATGCCATGG - Intergenic
1004066804 6:12254350-12254372 AGAGTGAGGAAAGGTTTACAAGG - Intergenic
1005025205 6:21456768-21456790 CAAGTGATAAAAGGGTTACAGGG - Intergenic
1005041018 6:21600611-21600633 CAAGAAAGCAAAGGGTTAAATGG + Intergenic
1005803294 6:29448356-29448378 CAAGTACAGAAAGGACTACTGGG + Intronic
1006568258 6:34978461-34978483 CAAGAAAAGAAAGGATTCTAAGG - Intronic
1007103697 6:39268794-39268816 CTAGTTAGGAAGGGTTTACAGGG - Intergenic
1007802782 6:44411881-44411903 CAAGTAAGGAATGTGTTTCAGGG + Intronic
1007896399 6:45365239-45365261 CAAGTAGTGGAAGGAGTACAGGG - Exonic
1008645963 6:53515097-53515119 CTTGTGAGTAAAGGATTACATGG + Intronic
1009707414 6:67270455-67270477 TAAGTCTGTAAAGGATTACATGG - Intergenic
1009964190 6:70561176-70561198 AGAATAAGCAAAGGATTACAAGG - Intergenic
1011123676 6:83983264-83983286 CAGGTAAAGAAAGCATTTCATGG + Intergenic
1011229774 6:85147582-85147604 CAGGCAAGGAAAGAAATACAGGG - Intergenic
1011402477 6:86978851-86978873 CCAGGAAGGAAAGGATTATGAGG - Intronic
1011873432 6:91926010-91926032 CAAGAAAGAAAAGAAATACAAGG - Intergenic
1012392144 6:98754298-98754320 AAAGAAATGAAAGAATTACATGG - Intergenic
1013979840 6:116116918-116116940 CAAGGAAGCAAAGGATCATAGGG + Intronic
1014727505 6:124990109-124990131 CAAGTGAAGAAAGTATTTCAAGG - Intronic
1014896304 6:126904159-126904181 CAAGGAAGGAAAACATCACATGG - Intergenic
1016804976 6:148203434-148203456 CAAATAAGGAAAGGAAAACTTGG + Intergenic
1020864686 7:13543298-13543320 AAAGTAATGAAAGGAAAACAAGG + Intergenic
1020985071 7:15123012-15123034 CAAGAAAAGAAAGCATGACAGGG - Intergenic
1021390072 7:20081986-20082008 CACATAAGCAAAGGATAACAAGG + Intergenic
1022367005 7:29731080-29731102 CAAGTAGTGAAATGATTTCATGG + Intergenic
1022770158 7:33462306-33462328 CAATCAATGAAATGATTACAAGG - Intronic
1022868783 7:34452946-34452968 CACGAAAGGAAATGAATACATGG - Intergenic
1023351995 7:39329698-39329720 CAAGCAAAGACAGGATTTCAGGG - Intronic
1027365803 7:77456484-77456506 CAAATAAAGAAAGGAGTAAAAGG + Intergenic
1029285999 7:99466475-99466497 CACGTGAGGAAAGGAGTTCAAGG - Intergenic
1029825262 7:103186377-103186399 CAAGTAATGAAATGATTTCATGG - Intergenic
1030895927 7:115059710-115059732 CAGGAAAGGAAAGTATTTCATGG + Intergenic
1031146582 7:118003638-118003660 CAACAAAGCAAATGATTACAAGG + Intergenic
1031204886 7:118744114-118744136 CAAGAAGTGAATGGATTACAGGG + Intergenic
1033234417 7:139626793-139626815 CAAGTAAGGACAGGTTACCAAGG + Intronic
1033272239 7:139942880-139942902 CAAGTCAGGAAATGCCTACAGGG - Intronic
1033603316 7:142906347-142906369 CAAGTATTAAAAAGATTACAGGG + Intergenic
1033806492 7:144960030-144960052 CAAGTAAGGAAAAAACTAAAAGG - Intergenic
1033968359 7:147006780-147006802 CCAGTAACAAAAGCATTACAAGG - Intronic
1036368273 8:8140279-8140301 CAAGGCAGGAAAGGACTACTCGG - Intergenic
1037032590 8:14127081-14127103 TATGTAAGGTAAGGTTTACATGG + Intronic
1037248952 8:16870114-16870136 CAAGGAAGGACATGATGACACGG + Intergenic
1039576885 8:38630696-38630718 CAAGTGAAGAAAGCATTTCAAGG + Intergenic
1041336949 8:56796310-56796332 AAAGTAAGGAGAGGAAAACAGGG - Intergenic
1041697255 8:60749070-60749092 CCAGTAAATAAAGAATTACAAGG + Intronic
1041797024 8:61756132-61756154 CAAGTGAGGTAAGGAATACAGGG - Intergenic
1042784724 8:72535547-72535569 AAACTAAGGCAAGGATGACATGG + Intergenic
1042889813 8:73596442-73596464 CAAAAAAGGATAGAATTACAAGG + Intronic
1043552232 8:81387169-81387191 CAAGTAAGGAGAGGGATGCAAGG - Intergenic
1044298031 8:90551019-90551041 CAAGTATGGAAAAGACAACAAGG - Intergenic
1044466695 8:92514824-92514846 CAAGAAAGGAAAGGGTGAGAGGG + Intergenic
1044680377 8:94771815-94771837 AAGGTAAGGAAAGGATAAAAGGG - Intronic
1045304763 8:100950391-100950413 CAAGTCAGGTAAGGGTTAAATGG - Intronic
1046805587 8:118475808-118475830 CAAAGAAGGAAAAAATTACATGG - Intronic
1047426149 8:124748693-124748715 TAAGTAATCAAAGGTTTACATGG - Intergenic
1047482615 8:125299413-125299435 CAAGCAAGGAATGTCTTACATGG + Intronic
1048052313 8:130829596-130829618 GAAGTCATGAAAGGATTATAAGG + Intronic
1048591581 8:135825514-135825536 CAAGTAAGCAAATCATTCCATGG - Intergenic
1048916792 8:139191977-139191999 CAAGAAATGAAAGGAATAGATGG - Intergenic
1048984540 8:139728200-139728222 CAAGGAAGGCAAGGATTCAAAGG - Intergenic
1051392910 9:16586051-16586073 AAATTGAGGAAAGAATTACAAGG - Intronic
1052312851 9:27087068-27087090 CAAAGAAGCAAATGATTACAGGG + Intergenic
1053377385 9:37619211-37619233 GATGTCAGGAAAGGTTTACATGG - Intronic
1054455686 9:65429153-65429175 CAAGTAAGGAAAGGGGAATAGGG + Intergenic
1056618945 9:88194390-88194412 CTAGAATGGAAAGGATTTCATGG + Intergenic
1056957469 9:91093546-91093568 AAATTAAGGGAAGGATTACCTGG + Intergenic
1059133840 9:111784109-111784131 CAAGTGAGGAAAGGAGGCCAAGG + Intronic
1060803547 9:126560145-126560167 TAAGAAAGGAAAGGATTAATAGG + Intergenic
1060870373 9:127035045-127035067 CAAATTAGTAAAGGATCACAGGG - Intronic
1060948025 9:127581822-127581844 AGAGGAAGGGAAGGATTACATGG - Intergenic
1188314602 X:28657757-28657779 CAAGCAAGGACAGGGTTAGAGGG - Intronic
1188829048 X:34873759-34873781 AAAGTAAGGCAAAGATTAAAGGG + Intergenic
1190339953 X:49288329-49288351 CAAGTGAAGAAAGGGTTGCAAGG - Intronic
1190549069 X:51559997-51560019 CAAGTAAGGAACGCTGTACAGGG + Intergenic
1191637948 X:63398128-63398150 CAAGTAAAGAAAGCTTTGCATGG - Intergenic
1192158136 X:68761848-68761870 AAAGAAAGGAAAGAAATACAAGG + Intergenic
1192925562 X:75751505-75751527 TAAGTGAGGAAAGTATTACAAGG - Intergenic
1193553584 X:82928532-82928554 GAAGTTAGGAAAGGACTAGATGG + Intergenic
1194483137 X:94452142-94452164 CCTGTAAGGTAAGGATTAGATGG - Intergenic
1195647400 X:107247959-107247981 CAAAAATGGACAGGATTACAAGG - Intergenic
1196003860 X:110814626-110814648 CAAGTGAAGAAAGTATTATATGG + Intergenic
1196070050 X:111510503-111510525 CTGGTAAGGCAAGGATTTCAAGG + Intergenic
1196763724 X:119223886-119223908 TAAGTAAGGAAAGTATTTCAGGG + Intergenic
1197610976 X:128637740-128637762 CAAGGGAAGAAAGGATTATATGG - Intergenic
1197856955 X:130923600-130923622 TAAGAAAGGAAATGATAACAAGG - Intergenic
1199059188 X:143333105-143333127 GAAAAAAGGTAAGGATTACAAGG + Intergenic
1199582645 X:149375894-149375916 CAAACAAGTAAATGATTACAAGG - Intergenic
1200129728 X:153834623-153834645 CAAGTAAGGAAAGGGCAACCCGG - Intergenic
1200883958 Y:8251289-8251311 CAAGTAAGCAAACTATCACAAGG - Intergenic
1201211632 Y:11686143-11686165 AAAGTATGGAAAGGATTCGAAGG + Intergenic
1201581316 Y:15514100-15514122 GAGGTAATAAAAGGATTACAGGG - Intergenic