ID: 979492008

View in Genome Browser
Species Human (GRCh38)
Location 4:121338909-121338931
Sequence GATGGAAAGCAAGTAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1866
Summary {0: 1, 1: 0, 2: 1, 3: 203, 4: 1661}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492008_979492011 -4 Left 979492008 4:121338909-121338931 CCTTTCCTTACTTGCTTTCCATC 0: 1
1: 0
2: 1
3: 203
4: 1661
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492008_979492015 10 Left 979492008 4:121338909-121338931 CCTTTCCTTACTTGCTTTCCATC 0: 1
1: 0
2: 1
3: 203
4: 1661
Right 979492015 4:121338942-121338964 GTTTTCAGGAGTTCTGATGTTGG 0: 1
1: 0
2: 2
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492008 Original CRISPR GATGGAAAGCAAGTAAGGAA AGG (reversed) Intronic
900017405 1:162232-162254 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
900047664 1:520828-520850 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
900069878 1:762696-762718 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
900273426 1:1806976-1806998 GAAAGAAAGAAAGAAAGGAAAGG + Intronic
900295859 1:1949096-1949118 AAAGGAAAGGAAGGAAGGAAAGG - Intronic
900295862 1:1949109-1949131 GAGGGAAGGGAAGAAAGGAAAGG - Intronic
900369532 1:2325155-2325177 GAAGGAAAGGAAGGAAGGGAGGG - Intronic
900369534 1:2325159-2325181 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
900369537 1:2325168-2325190 GAAGGAAGGGAAGGAAGGAAAGG - Intronic
900471905 1:2859237-2859259 GAAGGAGAGGAAGAAAGGAAGGG + Intergenic
900681668 1:3920111-3920133 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
900742493 1:4339249-4339271 GATGGGAAGTAAGACAGGAAGGG + Intergenic
901844360 1:11972621-11972643 GAGGGGAAGGAAGAAAGGAAGGG - Intronic
901978827 1:13017962-13017984 GAGGGAAATCAAGAAAGAAAAGG - Intronic
902003254 1:13210976-13210998 GAGGGAAATCAAGAAAGAAAAGG + Intergenic
902022479 1:13356727-13356749 GAGGGAAATCAAGAAAGAAAAGG + Intergenic
902197745 1:14810298-14810320 GAAGAAAAGCAAGCAAGGTACGG - Intronic
902260695 1:15222743-15222765 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
902632970 1:17716686-17716708 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
902756342 1:18551744-18551766 GAAGGAAAGAAAGAAAGGAAAGG + Intergenic
903483099 1:23669094-23669116 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
903544178 1:24113226-24113248 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
903595049 1:24487627-24487649 GAAGGAAAGGAAAGAAGGAAAGG + Intergenic
903651026 1:24922150-24922172 AAAGGAAAGGAAGGAAGGAAGGG - Intronic
903936034 1:26895541-26895563 AAAGGAAAGGAAGGAAGGAAGGG + Intronic
904168926 1:28577478-28577500 TCTGGAAAGCAAGCAAGGATGGG - Exonic
904180756 1:28665067-28665089 GAAAGAAAGAAAGTAAAGAAAGG + Intergenic
904212949 1:28897665-28897687 GAGGGAAGGGAAGAAAGGAAGGG + Intronic
904352366 1:29917197-29917219 GAAGGAAAGGAAGGAAGGGAGGG - Intergenic
904382966 1:30124040-30124062 GAGGAGAAGCAAGAAAGGAAGGG - Intergenic
904610727 1:31724939-31724961 GATGCAAAGCAAGAATGGACAGG + Intergenic
904775814 1:32905802-32905824 AAAAGAAAGCAAGGAAGGAAGGG - Intergenic
904805570 1:33129142-33129164 GATGGAAGGTAAGAATGGAATGG + Intergenic
905053493 1:35073370-35073392 GAAGGAAAGAAAGGAAAGAAAGG + Intronic
905520972 1:38599411-38599433 GAAGGAAAGCAGGATAGGAAGGG - Intergenic
905697585 1:39986816-39986838 GAAGGAAAGAAAGAAAGAAATGG - Intergenic
905753421 1:40486420-40486442 GAAGGGAAGGAAGGAAGGAAGGG - Intronic
905948325 1:41922821-41922843 GAAGGAAGGAAAGGAAGGAAGGG + Intronic
906025293 1:42668380-42668402 GATGGGAAGAAAGGAAGGAAAGG - Intronic
906185224 1:43857541-43857563 GAAGGAAAGGAAGGAAGGGAGGG - Intronic
906185226 1:43857545-43857567 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
906222323 1:44090732-44090754 AATAGAATGCAAGAAAGGAAAGG + Intergenic
906404445 1:45530514-45530536 GATAAAAAGCAAGTAAGGCAGGG + Intergenic
906933637 1:50193037-50193059 GATGGAAAGGAGGGAGGGAAAGG - Intronic
906999091 1:50831722-50831744 GATGGAATTAAAGTAAGGATTGG + Intronic
907016131 1:51014939-51014961 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
907108680 1:51906855-51906877 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
907264730 1:53250601-53250623 GATGGGAAGGAAGAAAGGATGGG + Intronic
907327261 1:53646891-53646913 GAAGGAAGGAAAGGAAGGAAGGG + Intronic
907327262 1:53646895-53646917 GAAGGAAAGGAAGGAAGGGAAGG + Intronic
907327286 1:53646984-53647006 GAAGGAAAGGAAGGAAGGGAGGG + Intronic
907760633 1:57355342-57355364 GAAGGGAAGGAAGGAAGGAAGGG - Intronic
908035400 1:60046233-60046255 GAAGGGAAGGAAGGAAGGAAGGG - Intronic
908224918 1:62046216-62046238 GAAGGAAGGAAAGGAAGGAAGGG + Intronic
908224920 1:62046220-62046242 GAAGGAAAGGAAGGAAGGGAGGG + Intronic
908340830 1:63177477-63177499 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
908674938 1:66592854-66592876 GAAAGAAAGGAAGGAAGGAAAGG - Intronic
909192796 1:72574986-72575008 TATAGAAGGGAAGTAAGGAATGG + Intergenic
909334186 1:74451596-74451618 GAAGGAAAGAAAGAAAAGAAAGG - Intronic
909399561 1:75211876-75211898 GAGAGAAAGGAAGGAAGGAAGGG - Intronic
909545564 1:76842750-76842772 GATTGAAAGGAAGTACGGAGAGG - Intergenic
909597302 1:77421150-77421172 AATGGAAAGAATGTCAGGAATGG - Intronic
909738734 1:79001115-79001137 GAAGGAAAAGAAGCAAGGAAGGG + Intronic
909845384 1:80387268-80387290 GATAGTAAGTAAGTAAGGAATGG - Intergenic
910171347 1:84380549-84380571 GACAGAAAGGAAGGAAGGAAGGG + Intronic
910341972 1:86198949-86198971 GATTGCTAGCAAGTAAAGAAAGG + Intergenic
910500071 1:87880247-87880269 GAAGGGAGGGAAGTAAGGAAAGG - Intergenic
910701953 1:90085013-90085035 GATAAAAAGGAAGGAAGGAAAGG - Intergenic
910735032 1:90444321-90444343 GAGAGAAAGGAAGGAAGGAACGG + Intergenic
910826076 1:91408593-91408615 GAGGGAAAGAAAGGAAGGAAGGG - Intergenic
911112975 1:94211452-94211474 GATGGAAAATAAGTAAGCATAGG + Intronic
911174616 1:94806670-94806692 GAGGGAAAGCAGAAAAGGAAAGG - Intergenic
911244956 1:95506815-95506837 GAAAGAAAGCAAGCAAAGAAAGG - Intergenic
911273107 1:95827539-95827561 TATGGAAATCACGTAAGAAAAGG - Intergenic
911292952 1:96080334-96080356 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
911430262 1:97776021-97776043 GAGGGAAAGCAGGTGGGGAAAGG + Intronic
911587120 1:99704356-99704378 GTTGGACAGCAAGTCAGGGAAGG + Intergenic
912011241 1:104966361-104966383 GAAGGAAAGGAAGGAAGGGAGGG - Intergenic
912011243 1:104966365-104966387 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
912039157 1:105363947-105363969 GAAGGAGAGCAATTACGGAAAGG - Intergenic
912106323 1:106281140-106281162 GATGGAAAGCATGTAATTATTGG - Intergenic
912275752 1:108256612-108256634 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
912527929 1:110298611-110298633 GGAGAAAAGCAAGTAGGGAATGG + Intergenic
912880476 1:113407345-113407367 GATTGATTGCAGGTAAGGAAGGG + Intronic
912974215 1:114313249-114313271 GAAAGAAAGAAAGAAAGGAATGG + Intergenic
913183882 1:116348948-116348970 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
913222624 1:116671155-116671177 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
913248084 1:116888005-116888027 GATGGAAACCAAAGAAGGAGGGG - Intergenic
913334168 1:117693465-117693487 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
913705567 1:121418889-121418911 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
913940371 1:125098101-125098123 GAAAGAAAGAAAGAAAGGAAGGG - Intergenic
914000540 1:143691025-143691047 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
914279682 1:146159449-146159471 GAAAGAAAGAAAGAAAGGAAGGG + Intronic
914334724 1:146704162-146704184 AATGGGAAGGAAGGAAGGAAGGG + Intergenic
914765322 1:150632278-150632300 CATGGAAAGCAAATGAAGAAAGG + Intergenic
915113025 1:153576708-153576730 GAAGGAAAGAAGGAAAGGAAGGG + Intergenic
915365600 1:155313710-155313732 GATGACAGGCAAGGAAGGAAGGG + Intronic
915681412 1:157585248-157585270 GAAGGAAAGAAAGGAAAGAAAGG - Intronic
915681413 1:157585257-157585279 GAAGGAAAGGAAGGAAAGAAAGG - Intronic
915691271 1:157693710-157693732 GAGAGAAAGGAAGGAAGGAAGGG - Intronic
915699645 1:157779414-157779436 GATGGGAGGGAATTAAGGAAAGG + Intergenic
916055254 1:161064833-161064855 GAAAGAAAGAAAGAAAGGAAAGG + Intronic
916276677 1:163001522-163001544 GAGGGAAAGCGAGGAAGAAAGGG - Intergenic
916540264 1:165746811-165746833 GATGGAGAGAAAGGAAGGGATGG + Intronic
916565663 1:165974777-165974799 GAAGGAAATGAAGAAAGGAAAGG - Intergenic
916565667 1:165974803-165974825 GAAGGAAAGGAAGGAAAGAAAGG - Intergenic
916810175 1:168298689-168298711 GAAGCAAAGGAAGGAAGGAAAGG - Intronic
916810183 1:168298724-168298746 GAAGGAAAGCTAGGAAGGAAAGG - Intronic
916810214 1:168298817-168298839 GAAAGAAAGAAAGAAAGGAAGGG - Intronic
916911318 1:169350187-169350209 GAAGGAAAGGAAGGAAAGAAAGG + Intronic
916911319 1:169350196-169350218 GAAGGAAAGAAAGGAAAGAAAGG + Intronic
916976590 1:170086766-170086788 GAAGGAAAGGAAGGAAGAAAGGG - Intergenic
917362821 1:174195662-174195684 GAAGGAAAGAAGGAAAGGAAAGG - Intronic
917471698 1:175331257-175331279 GAAAGAAAGAAAGGAAGGAAGGG - Intronic
917893169 1:179459841-179459863 GAAAGAAAGGAAGGAAGGAAGGG - Intronic
918018200 1:180659138-180659160 GATGGGAAAGAAGGAAGGAAAGG - Intronic
918440264 1:184559621-184559643 AAAGGAAAGAAAGTAAGGGAGGG - Intronic
918617083 1:186557452-186557474 GAGGGGAAGGAAGGAAGGAAGGG - Intergenic
918876026 1:190044904-190044926 GTTGGCAAATAAGTAAGGAAGGG - Intergenic
919058876 1:192606086-192606108 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
919162718 1:193852525-193852547 GCTGGGAAACAAGTAAGGAAGGG - Intergenic
919287911 1:195588692-195588714 GAAAGAAAGGAAGAAAGGAAGGG + Intergenic
919505927 1:198397523-198397545 GAAGGAAAGGGAGGAAGGAAGGG - Intergenic
919595956 1:199562742-199562764 GAAGGAAGGGAAGGAAGGAAAGG + Intergenic
919846110 1:201643224-201643246 GAAGGAAAGAAAGAAAGAAAAGG - Intronic
920165717 1:204034359-204034381 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
920271574 1:204768823-204768845 GAAAGAAAGAAAGGAAGGAAAGG - Intergenic
920617783 1:207510768-207510790 GAAGGAAAGGAAGGAAGGGAGGG - Intronic
920717048 1:208349929-208349951 GATGAAAAGCACTTAAGCAATGG - Intergenic
920769530 1:208868301-208868323 GATAGAAAAGAAGAAAGGAAGGG + Intergenic
921377658 1:214490948-214490970 GAAAGAAAGGAAGGAAGGAAGGG + Intronic
921377664 1:214490970-214490992 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
921592708 1:217022831-217022853 GGAGGGAAGAAAGTAAGGAAGGG + Intronic
921776502 1:219106507-219106529 GAAGGAAAGGAAGGAACGAAGGG - Intergenic
921776505 1:219106520-219106542 GAAAGAAAGAAAGGAAGGAAAGG - Intergenic
922244614 1:223783387-223783409 GTTGGTGAGGAAGTAAGGAAAGG - Intronic
922336793 1:224624563-224624585 GATGGGAAGCATGGAAGGGAGGG - Intronic
922375366 1:224958551-224958573 GATGGATTGTAAGAAAGGAATGG + Intronic
922543645 1:226437479-226437501 GAAAGAAAGCAAGAAAAGAAGGG - Intergenic
922654075 1:227365606-227365628 AATAGAAAGCAAGGAAGGAAGGG + Intergenic
922654087 1:227365652-227365674 GAAGGAAAGAAGGGAAGGAAGGG + Intergenic
922654095 1:227365683-227365705 GATGGAAAGGAAGAAAGGGAAGG + Intergenic
922655090 1:227375041-227375063 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
922810995 1:228415501-228415523 GATGGAAAGTGATTAAGGGAAGG - Exonic
922914983 1:229249885-229249907 GAAGGAAAGAAAGAAAGAAAAGG - Exonic
922954473 1:229587643-229587665 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
922979345 1:229812425-229812447 GAAGGAAAGAAAGAAAGGGAAGG + Intergenic
923235789 1:232031484-232031506 GAAGGAAAGAAAGAAAGGAAAGG + Intronic
923370321 1:233304608-233304630 GAGGGAAAGGAAGGAAGGATGGG + Intergenic
923678223 1:236098409-236098431 AAGGGAAAGGAAGAAAGGAAGGG + Intergenic
923742551 1:236669054-236669076 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
923776585 1:236984000-236984022 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
923985569 1:239377926-239377948 GAAGGAAAGAAAAGAAGGAAAGG + Intergenic
924064953 1:240211565-240211587 GATGGAAAGAAAGGAAAGAGTGG + Intronic
924153631 1:241153842-241153864 GATGGGAAGGAAGGAAGAAATGG + Intronic
924206178 1:241713377-241713399 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
924206192 1:241713415-241713437 GAAGGAAGGGAAGGAAGGAAGGG + Intronic
924206196 1:241713437-241713459 GAAGGAAAGAAAGGAAGGAAAGG + Intronic
924206201 1:241713459-241713481 GAAGGAAGGAAAGAAAGGAAGGG + Intronic
924234396 1:241988527-241988549 GAAGGAAAGAAAGAAAGAAAGGG - Intergenic
924347421 1:243085683-243085705 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
924423936 1:243933809-243933831 GAGGGAAAGGAAGGAAGGGAGGG - Intergenic
924573776 1:245260979-245261001 GAAGGAAAGGAAGGAAGGACAGG - Intronic
924574846 1:245270267-245270289 GAAGGAAAGAAGGAAAGGAAGGG - Intronic
924633476 1:245763576-245763598 GGTGGAAAGGAAGAGAGGAAGGG + Intronic
1062980361 10:1717493-1717515 GAGAGAAAGAAAGAAAGGAAAGG - Intronic
1063025951 10:2178874-2178896 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
1063178317 10:3571643-3571665 GATGGCCAGGAAGGAAGGAAAGG + Intergenic
1063197833 10:3759661-3759683 GAGGGAGAGGAAGTCAGGAAAGG + Intergenic
1063397884 10:5708680-5708702 AAAGGAAAGAAAGGAAGGAAAGG - Intronic
1063534215 10:6867031-6867053 GAAGGAAAGGAAGGAAGGAACGG - Intergenic
1063570095 10:7207490-7207512 GAAGGAAAGGGAGGAAGGAAAGG + Intronic
1063598437 10:7458624-7458646 GAAGGAAAGCAAGGAAGAGAGGG - Intergenic
1063894155 10:10661796-10661818 GAAGGGAAGCAAGTGAGGTAGGG + Intergenic
1063937771 10:11096938-11096960 TATAGAAAGGAAGGAAGGAAAGG - Intronic
1064210519 10:13357258-13357280 GAGAGAAAGAAAGGAAGGAAGGG - Intergenic
1064235854 10:13574435-13574457 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1064288885 10:14015247-14015269 GAAGGAAAGGAAGGAAGGGAGGG - Intronic
1064341543 10:14489997-14490019 GAAGGAAAGGAAGGAAAGAAAGG + Intergenic
1064460322 10:15528944-15528966 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
1064526348 10:16260500-16260522 GGAGGAAAGGAAGGAAGGAATGG + Intergenic
1064642108 10:17425731-17425753 GAAGGAAGGGAAGGAAGGAAGGG + Intronic
1064669716 10:17699325-17699347 GATGGAAAGGAAGACAGGAGGGG - Intronic
1064894597 10:20220488-20220510 GAAGGGAAGGAAGTAAAGAAAGG - Intronic
1065198097 10:23286465-23286487 GAAGGGAAGCAAAGAAGGAAGGG + Intronic
1065631591 10:27686356-27686378 GAAGGAAAGAAAGAAAGAAAGGG + Intronic
1065656745 10:27959252-27959274 GAAGGAAAGAAAGAAAGGAAAGG + Intronic
1065708768 10:28495368-28495390 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1065784846 10:29203641-29203663 GAAGGAAAAGAAGGAAGGAAAGG + Intergenic
1065797733 10:29322725-29322747 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1065825396 10:29566146-29566168 GAAAGAAAGGAAGAAAGGAAAGG - Intronic
1065952021 10:30660761-30660783 GAAAGAAAGGAAGAAAGGAAAGG + Intergenic
1065953698 10:30674821-30674843 GAAGGAAAGAAAGAAAGAAAGGG + Intergenic
1066131717 10:32401014-32401036 GGAGGAAAGGAAGGAAGGAAAGG - Intergenic
1066458802 10:35595446-35595468 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1066458806 10:35595459-35595481 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1066523381 10:36247954-36247976 GAAGGGAAGGAAGGAAGGAATGG - Intergenic
1066553337 10:36583964-36583986 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
1066728932 10:38419191-38419213 GAGGGAAGGAAAGGAAGGAAGGG - Intergenic
1067050859 10:43019477-43019499 GAGGAAAAGGAAGGAAGGAAGGG + Intergenic
1067099170 10:43322335-43322357 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1067195570 10:44114944-44114966 TAGGGACAGCAAGTAGGGAAGGG + Intergenic
1067220092 10:44337676-44337698 GATGCAAAGCAGAGAAGGAAAGG + Intergenic
1067957652 10:50810042-50810064 GCTGGAAAGCAAGTCAGTCAGGG + Exonic
1068024642 10:51628050-51628072 GAAGGAAAGAAAGAAAGGAAAGG - Intronic
1068024646 10:51628092-51628114 GAAGGAAAGAAAGAAAGGGAAGG - Intronic
1068043840 10:51860826-51860848 AATGGAAAGCATATAAGAAAAGG + Intronic
1068296364 10:55077450-55077472 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
1068329140 10:55538637-55538659 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1068329167 10:55538754-55538776 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1068329179 10:55538799-55538821 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1068329198 10:55538880-55538902 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1068329215 10:55538945-55538967 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1068411965 10:56667644-56667666 GGAGGAAAGAAAGGAAGGAAGGG - Intergenic
1068672956 10:59742666-59742688 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1068800964 10:61139336-61139358 GAAGGAAAGGAAGGAAGGGAGGG - Intergenic
1068830687 10:61491358-61491380 GAAGGAAAGAAAAGAAGGAAGGG + Intergenic
1068878209 10:62020212-62020234 TATTTAAAGCAAGAAAGGAAGGG + Intronic
1068886065 10:62098275-62098297 GATGGAAAGATACTCAGGAAGGG + Intergenic
1068960790 10:62864398-62864420 TAGGGAAAGGAAGGAAGGAAGGG + Intronic
1068987181 10:63118232-63118254 GATGGAAAGATAGGAAGCAAGGG - Intergenic
1069020401 10:63480854-63480876 TATAGAATGAAAGTAAGGAAAGG - Intergenic
1069149241 10:64934864-64934886 GGTAGAATGCATGTAAGGAAAGG - Intergenic
1069382128 10:67851944-67851966 GGAGGAAAGGAAGGAAGGAAAGG + Intergenic
1069637792 10:69936178-69936200 AAAGGAAAGGAAGGAAGGAAGGG + Intronic
1069646435 10:70001864-70001886 GGTGGCAAGCAATTAAGGAAAGG + Intergenic
1069725803 10:70577391-70577413 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1070163999 10:73884232-73884254 AAGGGAAAGAAAGGAAGGAAAGG - Intergenic
1070504192 10:77098750-77098772 GAAGGAAGGAAAGAAAGGAAAGG - Intronic
1070512911 10:77177349-77177371 GAAAGGAAGCAAGGAAGGAAAGG - Intronic
1070597910 10:77845607-77845629 GAAGGGAAGGAAGGAAGGAAGGG + Intronic
1070615557 10:77966935-77966957 GAAGAAAAGGAAGGAAGGAAGGG - Intergenic
1070694023 10:78548521-78548543 GAAAGAAAGAAAGGAAGGAAAGG + Intergenic
1071036711 10:81256184-81256206 GAGGGAAAGAAAGGAAAGAAAGG - Intergenic
1071374479 10:84988686-84988708 GAGGGAAGGAAAGGAAGGAAAGG - Intergenic
1071394345 10:85206842-85206864 GATGGCAGGCAGGTAAGGAAGGG - Intergenic
1071717397 10:88111094-88111116 CATGGAAAGCAACTAACCAAGGG + Intergenic
1071832075 10:89381748-89381770 GAAAGAAAGGAAGAAAGGAAAGG - Intronic
1071846310 10:89524678-89524700 GATGGAAAGCCTTTGAGGAAAGG - Intronic
1072037089 10:91573357-91573379 GAAGGAAAGAAAGAAAGAAAGGG + Intergenic
1072588325 10:96802875-96802897 GAAGGAAGGAAAGAAAGGAAAGG - Intergenic
1072594251 10:96856425-96856447 GAAGGAAAGAAAGGAAGGGAGGG - Intronic
1072609552 10:97008049-97008071 GAAGGAAGGCAAGCAAGGGAAGG + Intronic
1072731955 10:97852295-97852317 GATGCAAAGGAAGTCATGAAGGG + Intronic
1073109989 10:101056569-101056591 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1073149342 10:101301213-101301235 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
1073393412 10:103198072-103198094 GAGGGAGAGGAAGGAAGGAAGGG + Intergenic
1073654044 10:105393171-105393193 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1073832624 10:107403186-107403208 GATGGCAAGCAAATGAGAAAAGG + Intergenic
1073836421 10:107449018-107449040 AATGGAAAGAATGGAAGGAATGG + Intergenic
1073924229 10:108496529-108496551 GAGAGAAAGAAAGGAAGGAAAGG + Intergenic
1074235155 10:111577448-111577470 GAAAGAAAGCAAATAATGAAAGG - Intergenic
1074320957 10:112401898-112401920 GAAGGAAAGAAAGAAAGAAAAGG - Intronic
1074496710 10:113985960-113985982 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1074496711 10:113985964-113985986 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
1074763174 10:116682659-116682681 GAAGGAAATCAGGTCAGGAAAGG + Intronic
1074909674 10:117896539-117896561 AAAGGAAAGAAAGAAAGGAAGGG + Intergenic
1075153257 10:119953805-119953827 GAAGGAGAGGAAGGAAGGAAAGG - Intergenic
1075192734 10:120325858-120325880 GAGAGAAAGAAAGGAAGGAAAGG - Intergenic
1075236656 10:120736754-120736776 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1075482714 10:122796285-122796307 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
1075718747 10:124572638-124572660 GAAAGAAAGTAAGAAAGGAAAGG + Intronic
1076290567 10:129342541-129342563 GAGGGAAAGAAGGGAAGGAAGGG + Intergenic
1076530534 10:131141625-131141647 GTTGGAAAGGAGGAAAGGAAAGG - Intronic
1076663582 10:132071835-132071857 AAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1076663589 10:132071904-132071926 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1076663593 10:132071917-132071939 AAAGGAAAGAAAGGAAGGAAAGG - Intergenic
1076889837 10:133278000-133278022 CATGAAAAGCAAGAAAGCAAGGG + Intergenic
1076938884 10:133587070-133587092 AATGGAATGCAACTCAGGAATGG - Intergenic
1076974006 11:157460-157482 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
1077247238 11:1545642-1545664 GGAGGAAAGAAAGGAAGGAAGGG - Intergenic
1077970391 11:7182561-7182583 GTTTGGAAGAAAGTAAGGAAAGG + Intergenic
1077979816 11:7288319-7288341 GAAGAAAATCAACTAAGGAAGGG - Intronic
1078227519 11:9405849-9405871 GAAGGGAAGGAAGAAAGGAAGGG - Intronic
1078369647 11:10734353-10734375 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1078635385 11:13044815-13044837 GAAGGAAAGGAAGAAAGGAAGGG + Intergenic
1078924375 11:15860727-15860749 AAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1079200103 11:18369796-18369818 GATGGAAAGAAAGTCAGTAGTGG - Intergenic
1079266397 11:18937199-18937221 GATGGAAAAAAAATAAGGAAAGG - Intronic
1079445679 11:20554436-20554458 GAAGCAAAGGAAGGAAGGAAGGG - Intergenic
1079470651 11:20774224-20774246 GGAGGAAAGGAAGGAAGGAAGGG - Intronic
1079517670 11:21288124-21288146 GAATGAAAGGAAGGAAGGAAGGG + Intronic
1079517675 11:21288146-21288168 GAAGGAAAGAAAGGAAGGAAGGG + Intronic
1079565913 11:21882095-21882117 GATGGGAAGGGAGGAAGGAAGGG + Intergenic
1079750051 11:24185560-24185582 GAAGGGAAGAAAGGAAGGAAAGG + Intergenic
1079750055 11:24185573-24185595 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
1079750058 11:24185582-24185604 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1079750090 11:24185685-24185707 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1079750094 11:24185698-24185720 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1079750098 11:24185711-24185733 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1079750102 11:24185724-24185746 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1079750106 11:24185737-24185759 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1079775683 11:24523091-24523113 GACAGAAAGCAAGTCAGGGAAGG - Intronic
1080224514 11:29945281-29945303 GAGGGAAAGGAAGGAAAGAAAGG + Intergenic
1080237857 11:30092727-30092749 GAAGGAAGGAAAGAAAGGAAGGG - Intergenic
1080421877 11:32117887-32117909 GAAAGAAAGGAAGGAAGGAAAGG + Intergenic
1080479499 11:32631652-32631674 GAAGGAAAGGAAGGAAGGAAAGG + Intronic
1080576101 11:33600547-33600569 GAAGGAAAGGAAGGAAGGAGGGG - Intronic
1080736870 11:35024291-35024313 AATGGAAAGCAAAAAAGGAGAGG + Intergenic
1080880688 11:36317223-36317245 GCTGGAGAGGTAGTAAGGAATGG + Intronic
1081177927 11:39951806-39951828 GGTGGAAAGGAGGTAATGAAGGG + Intergenic
1081434095 11:43008050-43008072 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1081464812 11:43306664-43306686 GAAGGAAAGAAAGAAAGAAAAGG + Intergenic
1081834632 11:46143647-46143669 AAGGGAAACCAAGTCAGGAAAGG - Intergenic
1081947887 11:47014739-47014761 GAAGGAAAGGAAGGAAGGGAGGG + Intronic
1082040763 11:47682984-47683006 GAAGGAAAGAAAAGAAGGAAAGG + Intronic
1082805639 11:57447956-57447978 GAAGAAAAGAAAGGAAGGAAGGG + Intergenic
1083001802 11:59299064-59299086 GAAGGAAAGAAAGAAAGAAAGGG + Intergenic
1083041359 11:59690674-59690696 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1083044049 11:59716475-59716497 GAAGGAAAGAAAGAAAGGAAAGG - Intronic
1083338604 11:61944187-61944209 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
1083515785 11:63257476-63257498 GAAAGAAAGAAAGGAAGGAAGGG - Intronic
1083830575 11:65230046-65230068 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
1084356865 11:68644724-68644746 GAAGGAAAGAAAGGAAGGAAAGG + Intergenic
1084359315 11:68659532-68659554 GATGAAAAGCAAGTACTGAGCGG + Intergenic
1084495548 11:69501127-69501149 GATGGAAAGAAAGGAGGGAGGGG + Intergenic
1084528883 11:69715098-69715120 GAAAGAAAGAAAGAAAGGAAGGG + Intergenic
1084528898 11:69715162-69715184 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1084884281 11:72193350-72193372 GAAAGAAAGGAAGGAAGGAAGGG + Intronic
1085021360 11:73211548-73211570 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1085102118 11:73809795-73809817 AAAGGAATGGAAGTAAGGAAGGG + Intronic
1085435377 11:76494734-76494756 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1085478353 11:76802173-76802195 GATAGAAAGAAAGAAAGAAAGGG - Intergenic
1085966179 11:81529796-81529818 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
1085968249 11:81555244-81555266 GATTAAAAGCCTGTAAGGAAAGG - Intergenic
1086634553 11:89065671-89065693 GATGGAGAGCAATCAAGCAAGGG - Intronic
1086934207 11:92726856-92726878 AATGGAAAGGAAATAAGCAATGG + Intronic
1087263992 11:96041499-96041521 GAAGGAAAGGAAGGAAGGGAAGG + Intronic
1087400466 11:97659293-97659315 GAAAGAAAGAAAGAAAGGAAGGG + Intergenic
1087741217 11:101889269-101889291 AAAGGAAAGAAAGGAAGGAAAGG + Intergenic
1087975520 11:104541175-104541197 GAAGGAATGCAAGGAAGCAAAGG - Intergenic
1088123736 11:106398744-106398766 GAGAGAAAGAAAGGAAGGAAGGG - Intergenic
1088125931 11:106423373-106423395 GATGGAAACCAAGTAGGAAGGGG + Intergenic
1088145884 11:106677174-106677196 GAGGGAAGGAAAGGAAGGAAAGG + Intronic
1088265861 11:107987050-107987072 GATGGAAACCAACTGACGAAGGG + Intergenic
1088339366 11:108745259-108745281 GACGGAAGGAAAGGAAGGAAAGG - Intronic
1088394068 11:109347902-109347924 GAGGGAAGGGAAGTAAGGGAAGG - Intergenic
1088394079 11:109347931-109347953 GAGGGAAGGGAAGTAAGGGAAGG - Intergenic
1088676278 11:112196898-112196920 GAAGGAAGGAAAGGAAGGAAAGG - Intronic
1088772255 11:113046860-113046882 GAAAGAAAGGAAGGAAGGAAGGG + Intronic
1088798350 11:113283620-113283642 GAGGAGAACCAAGTAAGGAAAGG - Intergenic
1088917090 11:114235624-114235646 GAAAGAAAGAAAGAAAGGAAGGG - Intronic
1089714685 11:120347117-120347139 GAAGGAAAGAAAGAAAGAAAGGG - Intronic
1090067232 11:123513542-123513564 GAAGGAAGGAAAGAAAGGAAAGG - Intergenic
1090197829 11:124832153-124832175 GAAGGAAAGGAAGAAAGGAAGGG - Intergenic
1090907995 11:131094294-131094316 GAAGGAAAGGAAAGAAGGAAGGG - Intergenic
1091095924 11:132822061-132822083 GATAGAAAGTAAGCAAGGGAAGG - Intronic
1091182123 11:133614963-133614985 CATGGAAAGCAAGAATGAAAAGG - Intergenic
1091913632 12:4251724-4251746 GAAGGAAAGAGAGAAAGGAAGGG + Intergenic
1091997464 12:5005263-5005285 GATGGAAAGTCAGTAGGAAACGG + Intergenic
1092195549 12:6547768-6547790 GAAGGAAGGAAAGAAAGGAAAGG + Intronic
1092260079 12:6948541-6948563 GAAGGAAAGAAAGAAAAGAAAGG + Intronic
1092281456 12:7101063-7101085 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1092354538 12:7783603-7783625 GAAGGAAAGAAAGAAAAGAAAGG - Intergenic
1092907229 12:13112571-13112593 CAAGGAAAGCAGGTAAGGATGGG - Intronic
1093051222 12:14507128-14507150 AATGGAAGGGAAGTAAGGGAGGG + Intronic
1093123174 12:15297611-15297633 GATGGAAATCAAGAAAGAACAGG + Intronic
1093153926 12:15657275-15657297 GGAGTAAAGGAAGTAAGGAATGG - Intronic
1093773077 12:23039706-23039728 AAGGGAGAGCAAGTAAGGAAGGG + Intergenic
1094125972 12:27022664-27022686 GAGGTAAAGCAAGGGAGGAAAGG + Intronic
1094232442 12:28122485-28122507 GAAGGAAAGTAAGGAAGGAAGGG + Intergenic
1094280784 12:28735516-28735538 TATGGAAAGTAACTCAGGAATGG + Intergenic
1094285297 12:28785965-28785987 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
1094311689 12:29091101-29091123 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
1094615139 12:32029608-32029630 GAAAGAAAGGAAGAAAGGAAAGG + Intergenic
1094720918 12:33063199-33063221 GCTGGGAAGCAAGCAAGGTATGG + Intergenic
1094729568 12:33158930-33158952 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1094741924 12:33299443-33299465 GAGAGAAAGAAAGAAAGGAAAGG + Intergenic
1094741927 12:33299456-33299478 AAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1095350152 12:41200749-41200771 GATTGAAAGGAAGAAAAGAAGGG - Intronic
1095432626 12:42150314-42150336 CAAAGAAAGCAAGGAAGGAAGGG + Intergenic
1095501553 12:42845685-42845707 GAGGGAAAGGAAGGATGGAAAGG - Intergenic
1095526745 12:43135054-43135076 GGTGGTAAGCAATTAAGGAAAGG + Intergenic
1095875766 12:47079136-47079158 ATTGGAAAGAAAGTAAGGTATGG - Intronic
1096744477 12:53716424-53716446 AGTGGAAAGCAGGTAAGGAAAGG + Intronic
1096795418 12:54074427-54074449 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1096850258 12:54430924-54430946 GATGGGAAGGAAGCCAGGAAAGG + Intergenic
1097196703 12:57246360-57246382 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
1097374139 12:58819900-58819922 GACAGAAAGGAAGTATGGAAAGG + Intergenic
1097524440 12:60712746-60712768 TCTAGAAATCAAGTAAGGAATGG - Intergenic
1098155353 12:67592204-67592226 GAGAGAAAGAAAGGAAGGAAGGG + Intergenic
1098341283 12:69453918-69453940 GTAGGAAAGCAAATAAGAAATGG - Intergenic
1098503331 12:71220076-71220098 AATGGAAAGGAAGGAAGGTAAGG + Intronic
1098650334 12:72958641-72958663 GATTGAAAGCAGGTACAGAAGGG - Intergenic
1098697519 12:73578682-73578704 GAAGGAAAGGAAGGAAAGAAAGG - Intergenic
1098697526 12:73578713-73578735 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1098889606 12:75996015-75996037 GGTGGAATGCAAAAAAGGAAGGG - Intergenic
1098902189 12:76124384-76124406 GATGGAAGGAAAGGAAGGAAAGG - Intergenic
1099168740 12:79338628-79338650 GGAAGAAAGGAAGTAAGGAAGGG - Intronic
1099313152 12:81052910-81052932 GAAGGAAAGGAAGAAGGGAAGGG + Intronic
1099385409 12:82007203-82007225 TATGGAGAGCAAGTAAAGAATGG + Intergenic
1099570503 12:84311317-84311339 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
1099884411 12:88509408-88509430 GAAGGATAGCATCTAAGGAAGGG + Intronic
1100141163 12:91620530-91620552 GAGGGAAAGGCAGGAAGGAAGGG + Intergenic
1100243931 12:92737652-92737674 GAAAGAAAGGAAGGAAGGAAAGG + Intronic
1100303706 12:93331285-93331307 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1100387743 12:94119270-94119292 GAAGGAAAGGAAGGAAGGGAGGG - Intergenic
1100387745 12:94119274-94119296 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
1100438600 12:94594599-94594621 GAGGGGAAGCCAGCAAGGAAGGG + Intronic
1100453253 12:94727887-94727909 GAAGGACAGTAAGTGAGGAAAGG - Intergenic
1100748055 12:97667289-97667311 GGAGGAAAGGAAGGAAGGAAGGG + Intergenic
1100778917 12:98002915-98002937 GAAGGAAGGGAAGGAAGGAAAGG + Intergenic
1100778919 12:98002924-98002946 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1101151754 12:101889498-101889520 GAAGGAAAGGAAGGAAGGAAAGG + Intronic
1101255536 12:102973506-102973528 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1101658636 12:106746864-106746886 GAAGGATAGGAAGAAAGGAAGGG - Intronic
1101872104 12:108574547-108574569 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1102320517 12:111929553-111929575 GAAGGAAAGAAAGAAAAGAAAGG + Intergenic
1102406497 12:112678349-112678371 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
1102564672 12:113788035-113788057 GAGAGAAAGGAAGGAAGGAATGG + Intergenic
1102564693 12:113788317-113788339 GAAAGAAAGGAAGGAAGGAAAGG + Intergenic
1102673565 12:114640551-114640573 GAAAGAAAGAAAGAAAGGAAGGG - Intergenic
1102754131 12:115323165-115323187 GAAGGAAAGAAAGAAAGAAAGGG + Intergenic
1102807905 12:115798287-115798309 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
1102807906 12:115798291-115798313 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
1102808502 12:115803219-115803241 GGTGTTAAGCAAGTAATGAAGGG - Intergenic
1102886396 12:116525364-116525386 GAGGGAAAGAAAGAGAGGAAGGG - Intergenic
1102984040 12:117264512-117264534 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1102984056 12:117264570-117264592 GAAGGAAAAGAAGGAAGGAAGGG - Intronic
1103175626 12:118860925-118860947 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1103957342 12:124584770-124584792 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
1103977819 12:124715157-124715179 GAAAGAAAGAAAGGAAGGAAAGG + Intergenic
1104184120 12:126411819-126411841 GAGGGACAGTCAGTAAGGAAAGG + Intergenic
1104295207 12:127505744-127505766 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1104295216 12:127505774-127505796 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1104495581 12:129234194-129234216 GATGCTAAGAAATTAAGGAATGG + Intronic
1104508359 12:129353755-129353777 GATGGCAAGCAGGTCAGGGAAGG - Intronic
1104710858 12:130984859-130984881 GAAGGAAAGAAGGAAAGGAAGGG - Intronic
1105284449 13:18993121-18993143 GAAGGAAAGGAAGGAAGGGAGGG + Intergenic
1105944004 13:25174680-25174702 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
1106122315 13:26870823-26870845 GGTGGAAAACAAGGCAGGAAAGG - Intergenic
1106144883 13:27041402-27041424 GATGGAAATCAAGTGAGGGCTGG - Intergenic
1106583675 13:31038657-31038679 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
1106818347 13:33434860-33434882 ATTGGAAAGGAAGAAAGGAAGGG + Intergenic
1106954741 13:34924316-34924338 AAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1106976186 13:35219209-35219231 GAAGGAAGGCAAGGAAGGCAAGG - Intronic
1107045954 13:35992405-35992427 GAAGCAAACAAAGTAAGGAATGG - Intronic
1107318525 13:39160711-39160733 GAGGGAGAGGAAGGAAGGAAGGG + Intergenic
1107470232 13:40684894-40684916 GACAGAAAGAAAGGAAGGAAGGG - Intergenic
1107676910 13:42807146-42807168 GATGGAATCAAAGGAAGGAAGGG - Intergenic
1107788453 13:43977619-43977641 GAGGGAAAAAAAGGAAGGAAAGG - Intergenic
1107807634 13:44169187-44169209 GAAGGAAAGAAAGAAAGAAAGGG + Intergenic
1107819903 13:44277163-44277185 GATGGAAGGGAAGGAAAGAAGGG + Intergenic
1107846713 13:44521783-44521805 TTTGGAAAACAAGTAATGAAAGG - Intronic
1107861392 13:44664542-44664564 TATGGAAAACAAGAAAGGATTGG - Intergenic
1107865859 13:44702796-44702818 GAAGGAAAGAAAGCAAGAAAAGG - Intergenic
1108019888 13:46116785-46116807 GAGAGAAAGAAAGGAAGGAAGGG + Intergenic
1108157944 13:47606304-47606326 GATTGTAAGAAAGGAAGGAAGGG + Intergenic
1108436573 13:50406758-50406780 GGAGGAAAGAAAGAAAGGAAAGG - Intronic
1108513792 13:51178424-51178446 GCTGAACAGCAAGTAATGAAAGG + Intergenic
1108546613 13:51501644-51501666 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1108683446 13:52799078-52799100 GGAGGAAAGGAAGGAAGGAAGGG - Intergenic
1108790292 13:53961629-53961651 GAAGGAAAAGAAGGAAGGAAGGG - Intergenic
1109099392 13:58161198-58161220 GAAGGAAAGAAAGAAAGAAAGGG - Intergenic
1109121331 13:58461817-58461839 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
1109121337 13:58461839-58461861 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1109311288 13:60697270-60697292 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
1109348049 13:61141194-61141216 GAGGGAAGGCCAGCAAGGAAAGG - Intergenic
1109365601 13:61352300-61352322 GAAGGAAAGAAAGGAAGGAAAGG - Intergenic
1109373638 13:61458656-61458678 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1109518070 13:63470092-63470114 GAAGAAAAGGAAGGAAGGAAAGG - Intergenic
1110064271 13:71083510-71083532 GATGGAAATAAGGTGAGGAAGGG - Intergenic
1110066892 13:71119469-71119491 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1110097410 13:71545562-71545584 GGAGGAAAGGAAGGAAGGAAGGG + Intronic
1110402962 13:75115631-75115653 GAGGGAAGGAAAGGAAGGAAAGG + Intergenic
1110667605 13:78136186-78136208 GAAAGAAAGAAAGAAAGGAAGGG - Intergenic
1110701911 13:78558790-78558812 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
1110869252 13:80431625-80431647 GCTGTAAAACAAGAAAGGAAAGG + Intergenic
1110983376 13:81932628-81932650 GAGAGAAAGCAAGAAAGAAAGGG + Intergenic
1111275011 13:85936624-85936646 GAATGAAAGAAAGAAAGGAAGGG - Intergenic
1111295218 13:86268889-86268911 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1111446070 13:88347672-88347694 GAAGGAAAGAAAAAAAGGAAGGG + Intergenic
1111468041 13:88643387-88643409 AATGGAGAGCAAGTAAGGCAGGG - Intergenic
1111634483 13:90886312-90886334 GATGGAAAAAGAGTAAGGGAAGG + Intergenic
1111708407 13:91780481-91780503 AAAAGAAAGCAAGAAAGGAAGGG - Intronic
1111955076 13:94747778-94747800 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
1112030780 13:95454457-95454479 GAAGGGAAGGAAGGAAGGAAAGG + Intronic
1112611028 13:100954876-100954898 GCGGGAAAGCCAGTGAGGAATGG - Intergenic
1113337692 13:109392784-109392806 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
1113388760 13:109875550-109875572 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1113407635 13:110056414-110056436 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1113712538 13:112477824-112477846 GAAAGAAAGGAAGAAAGGAAGGG + Intergenic
1114071531 14:19112859-19112881 GATGGATAGACAGTAAAGAAGGG - Intergenic
1114090731 14:19287109-19287131 GATGGATAGACAGTAAAGAAGGG + Intergenic
1114911160 14:27199523-27199545 GAAGGAAAGGAAAGAAGGAAGGG - Intergenic
1115630181 14:35237052-35237074 GAAGGAAAGGAAGGAAGGGAAGG - Intronic
1115630182 14:35237056-35237078 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1115702874 14:35972338-35972360 GAGAGAAAGAAAGAAAGGAAGGG - Intergenic
1116549195 14:46213038-46213060 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
1116633533 14:47363733-47363755 AAGAGAAAGCAAATAAGGAAGGG + Intronic
1116863730 14:50014864-50014886 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1117068069 14:52030556-52030578 GAAAGAAAGAAAGGAAGGAAGGG + Intronic
1117191283 14:53294404-53294426 AAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1117435877 14:55714865-55714887 AAAGGAAAGCAAGTCAGGGAAGG - Intergenic
1117570501 14:57044388-57044410 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1118106399 14:62665033-62665055 GATGGAAAGCAATCAATTAAAGG + Intergenic
1118450284 14:65894361-65894383 AATGGAAAGCAAAAAAGCAAGGG + Intergenic
1118828531 14:69407280-69407302 GAAGGAAGGGAAGGAAGGAAAGG - Intronic
1118993176 14:70813859-70813881 GAAGGAAAGAAAGGAGGGAAGGG + Intergenic
1119593885 14:75916177-75916199 GAAGGAAAGAAGGGAAGGAAGGG + Intronic
1120022980 14:79551214-79551236 GAGGGAAAGAAAGGAAGGGATGG - Intronic
1120148930 14:81011197-81011219 GAAGAAAAGAAAGGAAGGAAGGG - Intronic
1120280378 14:82431117-82431139 GAGGGAAAGCTAATAAGGCAAGG - Intergenic
1120416246 14:84221733-84221755 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
1120416247 14:84221737-84221759 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
1120596948 14:86451959-86451981 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
1120653670 14:87164128-87164150 GAAAGAAAGAAAGGAAGGAAAGG - Intergenic
1120837469 14:89054379-89054401 GAAGGAAAGAAAGAAAGAAAAGG + Intergenic
1120970359 14:90201931-90201953 GAAAGAAAGCAAGCAAGCAACGG - Intergenic
1121007508 14:90499746-90499768 GAAAGAAAGGAAGCAAGGAAAGG + Intergenic
1121199055 14:92102238-92102260 GAAGGAAAGAAAGAAAGAAAAGG + Intronic
1121207131 14:92179153-92179175 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1121230187 14:92351893-92351915 GAAGGAAAGGAAGGAAGGAAAGG + Intronic
1121230189 14:92351902-92351924 GAAGGAAGGAAAGGAAGGAAAGG + Intronic
1121295402 14:92816923-92816945 GAAGGAAAGAAAGGAAAGAAAGG - Intronic
1121432378 14:93896720-93896742 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1121524935 14:94613200-94613222 GAAGGAAGGGAAGGAAGGAAAGG - Intronic
1121545620 14:94761242-94761264 GATGGAAAACAGGTCAGGCATGG - Intergenic
1121566851 14:94916305-94916327 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1121566852 14:94916309-94916331 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
1121657809 14:95610844-95610866 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
1121741836 14:96258005-96258027 GAAGGGAAGGAAGGAAGGAAGGG + Intronic
1121769097 14:96516319-96516341 GAAGGAAAGAAAGAAAGAAAAGG - Intronic
1121825239 14:97004978-97005000 GAAGGAACGGAAGGAAGGAAAGG - Intergenic
1121844222 14:97159104-97159126 GCTGGAATGCAAGGATGGAATGG - Intergenic
1121852562 14:97235748-97235770 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
1121971346 14:98359278-98359300 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1122546526 14:102525849-102525871 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1122794237 14:104197971-104197993 GAGAGAAAGAAAGGAAGGAATGG - Intergenic
1123022784 14:105409701-105409723 GAATGAAAGAAAGAAAGGAAGGG - Intronic
1123465777 15:20514267-20514289 GATTGAAAGCAAAAAAAGAAGGG - Intergenic
1123652337 15:22486772-22486794 GATTGAAAGCAAAAAAAGAAGGG + Intergenic
1123742759 15:23295635-23295657 GATTGAAAGCAAAAAAAGAAGGG + Intergenic
1123760566 15:23428857-23428879 GATTGAAAGCAAAAAAAGAAGGG - Intergenic
1124069512 15:26378463-26378485 GATAGAAAGGAAGAAAGGAAAGG - Intergenic
1124172418 15:27387956-27387978 GAGGGGAAGAAAGGAAGGAAAGG + Intronic
1124172505 15:27388241-27388263 GGAGGAAAGGAAGGAAGGAAAGG + Intronic
1124206130 15:27722623-27722645 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
1124276501 15:28330244-28330266 GATTGAAAGCAAAAAAAGAAGGG - Intergenic
1124306200 15:28581363-28581385 GATTGAAAGCAAAAAAAGAAGGG + Intergenic
1124399185 15:29333583-29333605 AATGGAATGCAAATGAGGAAGGG - Intronic
1124424734 15:29554346-29554368 GAAGGTAAGGAAGGAAGGAAAGG + Intronic
1124458654 15:29868579-29868601 TATGGAAAGGAAGAAAGGGAAGG + Intronic
1124562557 15:30788806-30788828 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1124623183 15:31291313-31291335 GAAGGAAAGGAAGGAGGGAAGGG - Intergenic
1124984424 15:34592166-34592188 AAAGCAAAGCGAGTAAGGAAGGG - Intergenic
1124994496 15:34709641-34709663 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
1125022790 15:35001698-35001720 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1125024426 15:35016468-35016490 ACTGGAAATCAAGTAAAGAAAGG + Intergenic
1125185720 15:36927393-36927415 GAAGGAAACGAAGGAAGGAAGGG + Intronic
1125334963 15:38617930-38617952 GATGGAAAGCAAATAAAGTAGGG + Intergenic
1125438006 15:39668732-39668754 TGTGGTAAGCAAGCAAGGAAAGG - Intronic
1125586479 15:40824208-40824230 TATGGAAAGGAAGTAAGAAAGGG - Intronic
1125746967 15:42003887-42003909 GAAGGAAAGCAAGGAAAGGAAGG - Intronic
1125746968 15:42003891-42003913 GAAGGAAGGAAAGCAAGGAAAGG - Intronic
1126051120 15:44685726-44685748 AATGGAAAGCAAATAAAGCAGGG + Intronic
1126150720 15:45521980-45522002 CATGAAAAGCAAGTACAGAACGG + Exonic
1126172496 15:45706008-45706030 GACAAAAAACAAGTAAGGAAAGG - Intergenic
1126370535 15:47941209-47941231 GAAGGAAAGGAAGGAAAGAAAGG + Intergenic
1126370537 15:47941218-47941240 GAAGGAAAGAAAGGAAAGAAGGG + Intergenic
1126370544 15:47941251-47941273 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1126461014 15:48914634-48914656 GGTGAAAAGCAAATAAGAAAAGG - Intronic
1126479749 15:49104851-49104873 GGTGAGAAACAAGTAAGGAAAGG + Intergenic
1126544371 15:49856532-49856554 GTAGGAAAGGAAGGAAGGAAGGG + Intergenic
1126762170 15:51979117-51979139 GAGAGAAAGAAAGGAAGGAAGGG + Intronic
1126882808 15:53117444-53117466 GAAGGGAAGGAAGGAAGGAAAGG - Intergenic
1126915459 15:53461229-53461251 GTTGGAAAGCCAGTCAGAAATGG + Intergenic
1126936078 15:53709241-53709263 GATAAAAGGCAAGTAAGGACAGG + Intronic
1127015095 15:54675989-54676011 AATGGAAATGAAGGAAGGAAAGG + Intergenic
1127293501 15:57591038-57591060 GATGGAAGGAAAGCAAGGGAAGG - Intergenic
1127375864 15:58383813-58383835 GATGGAAAGGCAGAAAGGGAAGG - Intronic
1127385644 15:58464520-58464542 GATGAATAGCAACTAAAGAATGG - Intronic
1127474099 15:59316065-59316087 GAGACAGAGCAAGTAAGGAAAGG + Intronic
1127517799 15:59713343-59713365 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1127696082 15:61449242-61449264 GAAGGAAAGGAAGGAAGAAAAGG - Intergenic
1128478686 15:68018995-68019017 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1128480627 15:68034816-68034838 GAAGGAAAGAAAGAAAAGAAAGG - Intergenic
1128861778 15:71080296-71080318 GCTGGTAAGTAAGTGAGGAATGG - Intergenic
1128883920 15:71267778-71267800 AATGGAAAGCAAAAAAGGCATGG + Intronic
1128907412 15:71480030-71480052 GAAAGAAAGAAAGGAAGGAAAGG - Intronic
1129557876 15:76532330-76532352 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
1129907898 15:79202515-79202537 GATGGAAATCCTATAAGGAAGGG + Intergenic
1129965531 15:79731732-79731754 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
1130186788 15:81690877-81690899 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
1130268053 15:82427252-82427274 AATGGAAAGCAAGAAAGAAAAGG - Intergenic
1130483648 15:84384613-84384635 AATAGAAAGCAAGAAAGAAAAGG - Intergenic
1130503971 15:84519582-84519604 AATGGAAAGCAAGAAAGAAAAGG + Intergenic
1130761523 15:86825634-86825656 GAAGGAAGGAAAGAAAGGAAGGG + Intronic
1130761524 15:86825638-86825660 GAAGGAAAGAAAGGAAGGGAAGG + Intronic
1130943846 15:88535770-88535792 GAAAGAAAGAAAGGAAGGAAGGG + Intronic
1131081388 15:89539190-89539212 GAAGGAGAGGAAGGAAGGAAAGG + Intergenic
1131159017 15:90092363-90092385 GAAGGAAGGAAAGAAAGGAAAGG - Intronic
1131229956 15:90652634-90652656 GATGGAAAGGATGAAAAGAATGG - Intergenic
1131405567 15:92161437-92161459 CAGGGAACGGAAGTAAGGAAGGG + Intronic
1131449342 15:92526126-92526148 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1131700164 15:94926855-94926877 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1131909986 15:97187955-97187977 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
1131909988 15:97187964-97187986 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1132918064 16:2364822-2364844 GAAGGGAAGAAAGGAAGGAAAGG + Intergenic
1132918066 16:2364835-2364857 GAAGGAAAGGAAGGAATGAAAGG + Intergenic
1133151912 16:3839745-3839767 GAAGGAAAGGAAGGGAGGAAAGG + Intronic
1133396898 16:5454818-5454840 GAAAGAAAGCAAGGAAAGAAAGG - Intergenic
1133582027 16:7153742-7153764 TAAGGAAAGAAAGAAAGGAAAGG + Intronic
1133631435 16:7625775-7625797 GATGGGAAGGAAGAAAAGAAAGG - Intronic
1133819731 16:9225938-9225960 GAAAGAAAGCAGGCAAGGAAGGG - Intergenic
1133862043 16:9605242-9605264 GGGGGAAAGGAAGGAAGGAAAGG - Intergenic
1133863681 16:9621075-9621097 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1133927317 16:10203777-10203799 GAAAGAAAGAAAGAAAGGAAGGG + Intergenic
1134012755 16:10867412-10867434 GAGGGAGAGCGAGAAAGGAAGGG + Intergenic
1134261419 16:12654235-12654257 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1134268223 16:12709964-12709986 GAAGGCAAGGAAGGAAGGAAGGG + Intronic
1134348762 16:13416771-13416793 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
1134440516 16:14297041-14297063 GAGAGAAAGAAAGGAAGGAAAGG - Intergenic
1134650213 16:15902681-15902703 GATCGAAAGTCAGAAAGGAAAGG - Intergenic
1134751743 16:16630745-16630767 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
1134754037 16:16650664-16650686 GAGGGAAAGGAAGGAAGGAAAGG - Intergenic
1134881335 16:17747393-17747415 GGAGGAAAGGAAGAAAGGAAAGG + Intergenic
1134992022 16:18708380-18708402 GAGGGAAAGGAAGGAAGGAAAGG + Intergenic
1135123532 16:19786853-19786875 GAAGGAAAGAAAGAAAGAAAAGG + Intronic
1135166820 16:20146474-20146496 GAAGGAAAGAAGGTATGGAAGGG + Intergenic
1135464566 16:22674237-22674259 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
1135543337 16:23348988-23349010 GAAGGAAGGAAAGGAAGGAAAGG - Intronic
1135610973 16:23866942-23866964 GAAGGGAAGGAAGAAAGGAAGGG - Intronic
1135612651 16:23882060-23882082 AAAGGAAAGAAAGAAAGGAAAGG - Intronic
1135726890 16:24861501-24861523 AAAGGAAAGAAAGGAAGGAAGGG + Intronic
1135770455 16:25214371-25214393 GAAGGGAAGAAAGAAAGGAAGGG - Intergenic
1135795064 16:25433824-25433846 GACGGAAGGGAAGGAAGGAAGGG - Intergenic
1135927709 16:26709880-26709902 GAAGGGAAGAAAGGAAGGAAGGG + Intergenic
1135954132 16:26941436-26941458 GCTGGAAAGGAATTAAGAAAAGG - Intergenic
1136065176 16:27753836-27753858 GAAAGAAAGGAAGGAAGGAAAGG - Intronic
1136604479 16:31324161-31324183 GAAGAAAAGGAAGGAAGGAAAGG + Intronic
1136675253 16:31898858-31898880 GATGGAAAGCAAAAAAAGCAGGG + Intronic
1137888250 16:52129552-52129574 GAAGGAGAGAAAGGAAGGAAAGG + Intergenic
1137936153 16:52637435-52637457 AAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1137987947 16:53126631-53126653 GAACGAAAGGAAGGAAGGAAGGG - Intronic
1138164454 16:54788088-54788110 GAAGGAAAGGAAGGAAAGAAAGG - Intergenic
1138695166 16:58806352-58806374 CATGGAAACAAAGAAAGGAATGG + Intergenic
1138995539 16:62448074-62448096 GATGAAAAGAAAGAAAGAAAGGG + Intergenic
1139126819 16:64088507-64088529 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
1139131180 16:64148190-64148212 GAGGGAAGGGAAGGAAGGAAGGG - Intergenic
1139147424 16:64341507-64341529 GAAGGAAAGGAAGGAAGGAGAGG - Intergenic
1139221379 16:65185953-65185975 GAAGGAAAGAAAGAAAGGGAGGG - Intergenic
1139518920 16:67468616-67468638 GAAGGAAAGAAAGAAAGGAAAGG + Intronic
1139736380 16:68992665-68992687 GTTGAAAAGCAAACAAGGAACGG - Intronic
1140024300 16:71270369-71270391 GACGGAAAGAAAGGAAAGAAAGG + Intergenic
1140081713 16:71754348-71754370 GAAAGAAAGAAAGGAAGGAAAGG + Intronic
1140386324 16:74542713-74542735 GAAGGGAAGGAAGGAAGGAAGGG + Intronic
1140423591 16:74841681-74841703 AAAGGAAAGAAAGGAAGGAAAGG + Intergenic
1140436228 16:74949377-74949399 GAAGGAAAGACAGGAAGGAAGGG + Intronic
1141089336 16:81119489-81119511 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
1141090839 16:81129341-81129363 GAGGGAAGGGAAGGAAGGAAGGG - Intergenic
1141190886 16:81823897-81823919 GATGGAAGGAAAGGAAGGAAGGG - Intronic
1141235244 16:82210040-82210062 GAGGGAAGGAAAGGAAGGAAGGG - Intergenic
1141376509 16:83535827-83535849 GAAGGAAAGGAAGGAAGGGAGGG + Intronic
1141506727 16:84482905-84482927 GAGGGACAGCTAATAAGGAATGG + Intronic
1141647087 16:85373397-85373419 AATGGAAAGAAAGCAAGGGAGGG + Intergenic
1141711542 16:85702373-85702395 GAAGGAAAAGAAGGAAGGAAAGG - Intronic
1142066472 16:88065806-88065828 CAAGGAAAGCGAGTATGGAAGGG + Intronic
1142446257 16:90140225-90140247 GAGGGAAGGAAAGGAAGGAAGGG - Intergenic
1203143394 16_KI270728v1_random:1783750-1783772 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1203143399 16_KI270728v1_random:1783767-1783789 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1203143424 16_KI270728v1_random:1783847-1783869 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1203143429 16_KI270728v1_random:1783864-1783886 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1203143433 16_KI270728v1_random:1783877-1783899 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1142461248 17:95238-95260 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
1142475544 17:186800-186822 GATGGAGGGGAAGTCAGGAAGGG + Intergenic
1142832877 17:2562329-2562351 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1142832890 17:2562388-2562410 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1142950020 17:3471186-3471208 GAAGGGAAGGAAGGAAGGAAGGG + Intronic
1143330039 17:6127397-6127419 GAAGGAAAGAAAGAAAAGAAAGG - Intergenic
1143567438 17:7732755-7732777 GATAGAAAGAAAGGATGGAATGG - Intronic
1143747946 17:9007154-9007176 GAAGGAAGGAAAGAAAGGAAAGG - Intergenic
1143747969 17:9007434-9007456 GAAGGGAAGAAAGGAAGGAAGGG - Intergenic
1144018622 17:11220712-11220734 GAGGGAAGGGAAGGAAGGAATGG - Intergenic
1144089154 17:11838133-11838155 GAGGGAAAGGAAGTCAGTAACGG + Intronic
1144212341 17:13026025-13026047 GAGAGAAAGAAAGGAAGGAAGGG - Intergenic
1144352914 17:14415860-14415882 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1144518528 17:15938208-15938230 GTTAGAAAGGAAGGAAGGAAAGG + Intergenic
1144712104 17:17408291-17408313 GAAAGAAAGAAAGGAAGGAAAGG + Intergenic
1144993987 17:19254191-19254213 GAGGGAAGGAAAGGAAGGAAAGG + Intronic
1145817074 17:27803111-27803133 GAGGGAAAGGAGGAAAGGAAAGG + Intronic
1146819352 17:35972191-35972213 GATGGAAAGCGATTTAGCAAAGG - Intergenic
1146949978 17:36899252-36899274 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1147205089 17:38831581-38831603 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1147347482 17:39811415-39811437 GAAGAAAAGGAAGGAAGGAAAGG + Intronic
1147366923 17:39965173-39965195 GAAGGGAAGGAAGGAAGGAAGGG + Intronic
1147388938 17:40097671-40097693 CAAGGAAGGCAACTAAGGAAGGG - Intronic
1147495039 17:40907455-40907477 GAAGGAAAACAGGAAAGGAAAGG - Intergenic
1148044379 17:44733655-44733677 GAAGGAAATCAAGTCAGAAATGG - Intronic
1148378420 17:47171808-47171830 GATGGAAAACAGGGAAGAAAGGG + Intronic
1148616640 17:49005507-49005529 GCTGGAAGGCATGTAAGGGATGG + Intronic
1148798044 17:50206795-50206817 GAAAGAAAGGAAGAAAGGAATGG - Intergenic
1148922445 17:51050991-51051013 GAAGGAAAGAAAGAAAAGAAAGG + Intronic
1149639935 17:58195985-58196007 GAAGGGAAGGAAGGAAGGAAAGG - Intronic
1149639939 17:58196002-58196024 GAAGGAAATGAAGGAAGGAAGGG - Intronic
1150296815 17:64014487-64014509 GAAAGAAAGGAAGGAAGGAAGGG + Intronic
1150837006 17:68573535-68573557 GAGGGAAAGAAAGGAAAGAAAGG - Intronic
1150884849 17:69072918-69072940 AATGGAAAGCAAATAAAGCAGGG + Intergenic
1150968773 17:70003007-70003029 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1151078488 17:71301485-71301507 GAAGGAAAGGAAAGAAGGAAGGG - Intergenic
1151310510 17:73289764-73289786 GAAGGAAAGGAAGGAAGGAAAGG + Intronic
1151529273 17:74694230-74694252 CATGGGAAGCATCTAAGGAAGGG + Intronic
1151845260 17:76649535-76649557 GATGGAAGAGAAGGAAGGAAGGG - Intergenic
1151988130 17:77557130-77557152 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
1152109007 17:78346957-78346979 GAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1152256828 17:79244816-79244838 GAAGGAAAAGAAGGAAGGAAAGG - Intronic
1152396151 17:80035191-80035213 GAAGGAAAGAAAAAAAGGAAAGG - Intronic
1152432115 17:80254247-80254269 GAAGGGAAGGAAGGAAGGAAAGG - Intergenic
1152484476 17:80581269-80581291 GAAAGAAAGCAAGGGAGGAAGGG - Intronic
1152486044 17:80594019-80594041 GAAGGAAAGAAAGGAACGAACGG - Intronic
1152652852 17:81503892-81503914 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
1153216204 18:2823328-2823350 GAAGGAAAGAAAGAAAAGAAAGG - Intergenic
1153257522 18:3186850-3186872 AAGGGAAAGGAAGGAAGGAAGGG + Intronic
1153538131 18:6125174-6125196 GGAGGAAAGGAAGGAAGGAAGGG + Intronic
1154095785 18:11413771-11413793 GAAGGAAAGCAGGAAAGGAAGGG - Intergenic
1154372802 18:13779929-13779951 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
1154511677 18:15110692-15110714 GAGAGAAAGAAAGGAAGGAAGGG - Intergenic
1154515878 18:15164850-15164872 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1155048979 18:22130130-22130152 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
1155058231 18:22204266-22204288 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1155147383 18:23095315-23095337 CAAGTAAAGAAAGTAAGGAAGGG + Intergenic
1155293364 18:24363626-24363648 GATAGAAAGGAAGGAAGGAAGGG - Intronic
1155361386 18:25006692-25006714 GATGGCAAGCAATGAAGGGAAGG - Intergenic
1155878672 18:31117526-31117548 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1155965022 18:32027622-32027644 GATGAAAAGCCAGCAAAGAAAGG - Intronic
1156076797 18:33288396-33288418 GAAGAAAAGGAAGGAAGGAAGGG - Intronic
1156076808 18:33288437-33288459 GAAGAAAAGGAAGGAAGGAAGGG - Intronic
1156559604 18:38107728-38107750 GTAGCAAAGCAAGCAAGGAATGG + Intergenic
1156638501 18:39061037-39061059 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1156702178 18:39839313-39839335 GGAGGAAAGGAAGTAAAGAAAGG + Intergenic
1156781736 18:40858227-40858249 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
1156838269 18:41581717-41581739 GAAGGAAAAGAAGGAAGGAAGGG - Intergenic
1156870150 18:41936771-41936793 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1156870153 18:41936784-41936806 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1156981552 18:43294999-43295021 GAAAGCAAGCAAGAAAGGAAAGG + Intergenic
1157007473 18:43601663-43601685 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1157103159 18:44748184-44748206 GATGGAAAGGAAGGATGGGAAGG + Intronic
1157277231 18:46319892-46319914 GAGGGAAAGAAAGAGAGGAAAGG - Intergenic
1157499563 18:48180088-48180110 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1157499566 18:48180097-48180119 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1157955329 18:52090622-52090644 GATGCCAAGCTAGTAAGGAGTGG + Intergenic
1158153093 18:54394372-54394394 GAAGCAAAGAAAGGAAGGAAAGG - Intergenic
1158281096 18:55828283-55828305 CATGGAAAGCAAGAAAGGACTGG - Intergenic
1158321729 18:56270750-56270772 GAAGGAAAGGAAGAAGGGAAGGG + Intergenic
1158334916 18:56405665-56405687 GAAGGGAAGGAAGGAAGGAAAGG + Intergenic
1158700064 18:59737581-59737603 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1158736873 18:60092452-60092474 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
1159024406 18:63169327-63169349 GAAAGAAAGAAAGGAAGGAAAGG - Intronic
1159352551 18:67294582-67294604 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1159442036 18:68493794-68493816 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
1159685198 18:71410310-71410332 GAAGGGAAGGAAGGAAGGAAAGG + Intergenic
1160231977 18:77055504-77055526 GAAGGAAAGGAAGGAAAGAAAGG - Intronic
1160545030 18:79647361-79647383 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1160650949 19:227605-227627 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
1160912362 19:1480782-1480804 GAAGGAAAGAAAGAAAGAAAAGG + Intergenic
1160951506 19:1669758-1669780 GAGGGAAGGAAAGGAAGGAAAGG - Intergenic
1160951518 19:1669824-1669846 GAGGGAAGGAAAGGAAGGAAAGG - Intergenic
1161254380 19:3298926-3298948 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1161254388 19:3298980-3299002 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1161416743 19:4151472-4151494 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1161419301 19:4167458-4167480 GAAGGAAAGAAAGGAAGAAAAGG + Intronic
1161427725 19:4213249-4213271 GAAGGAAAGGAAAGAAGGAAAGG - Intronic
1161427744 19:4213320-4213342 GAAGGAAAGGAAGGAAGGGAAGG - Intronic
1161427745 19:4213324-4213346 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1161600590 19:5179918-5179940 GAAAGAAAGGAAGGAAGGAAAGG - Intronic
1161696572 19:5771999-5772021 GAAGGAAATGAAGGAAGGAAGGG - Intronic
1161705247 19:5817431-5817453 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
1161705279 19:5817580-5817602 GAGGGAAAGAGAGGAAGGAAGGG + Intergenic
1161878079 19:6927260-6927282 GAAGGAAGGCAAGGAAGGAAGGG - Intronic
1161970575 19:7577526-7577548 GAAAGAAAGGAAGGAAGGAAAGG + Intergenic
1162051604 19:8037328-8037350 GAGAGAAAGGAAGGAAGGAAGGG - Intronic
1162066756 19:8130628-8130650 GAAAGAAAGAAAGAAAGGAAAGG + Intronic
1162072934 19:8165827-8165849 GAAGGAAGGAAAGAAAGGAAGGG + Intronic
1162251174 19:9444801-9444823 GAGGGAAAGGAGGAAAGGAAAGG + Intergenic
1162269671 19:9603950-9603972 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1162398010 19:10429186-10429208 GAAGGAAGGAAAATAAGGAAAGG + Intronic
1162704126 19:12542665-12542687 AAAGGAAAGGAAGGAAGGAAAGG + Intronic
1162809884 19:13157510-13157532 GAAAGAAAGGAAGAAAGGAAGGG - Intergenic
1162845945 19:13392721-13392743 GAAGGAAGGGAAGGAAGGAAAGG - Intronic
1162912411 19:13855498-13855520 AAAGGAAAGAAAGGAAGGAAAGG + Intergenic
1162945168 19:14038904-14038926 GAGAGAAAGCAAGGAAGGAAGGG + Intronic
1162987633 19:14281269-14281291 GAAGGAAAGGAATGAAGGAAAGG - Intergenic
1163109066 19:15147243-15147265 GAGGGAAAGAAAGGAAGAAAGGG + Intergenic
1163260049 19:16183925-16183947 GATGAAAAGAAAGAAAGAAAGGG + Intergenic
1163351987 19:16782920-16782942 GAAGGGAAGGAAGGAAGGAAAGG - Intronic
1163478072 19:17538770-17538792 GAGGGAAAGGAAGGAAGAAAGGG + Intronic
1163504247 19:17695458-17695480 GAAGGAAAGAGAGAAAGGAAAGG + Intergenic
1163538475 19:17892327-17892349 GAGGGAAAAGAAGGAAGGAAAGG + Intronic
1163657381 19:18555019-18555041 GAAGGAAAGAAAGGAAGGGAGGG - Intergenic
1163861286 19:19744266-19744288 GAAGGAAAGAAGGAAAGGAAAGG - Intergenic
1164420047 19:28081803-28081825 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1164420052 19:28081833-28081855 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1164588678 19:29494478-29494500 GGAGGAAGGTAAGTAAGGAAGGG + Intergenic
1164714926 19:30384354-30384376 GAAAGAAAGAAAGGAAGGAAGGG - Intronic
1164757365 19:30700136-30700158 GAAGGAAAGAAGGGAAGGAAGGG - Intronic
1164807811 19:31130337-31130359 GACTGAAAGCAGGTAAGGAGTGG - Intergenic
1164908541 19:31986869-31986891 GATGGGAAGCTGGTAAGGCAGGG + Intergenic
1164953599 19:32361677-32361699 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1164953602 19:32361690-32361712 GAAGGAAGGAAAGGAAGGAAAGG - Intronic
1164953604 19:32361699-32361721 AAAGGAAAGGAAGGAAGGAAAGG - Intronic
1164953607 19:32361712-32361734 GAAGGAAAGGAAGAAAGGAAAGG - Intronic
1164953628 19:32361794-32361816 GAAGGAAACGAAGGAAGGAAAGG - Intronic
1164953633 19:32361820-32361842 AAAGGAAAGGAAGAAAGGAAAGG - Intronic
1164953635 19:32361833-32361855 GAAGGAAAGGAAGAAAGGAAAGG - Intronic
1164953637 19:32361846-32361868 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1165255391 19:34574747-34574769 GATGGACACCAAGTAACCAATGG - Intergenic
1165789782 19:38484402-38484424 GAGGGGAAGGAAGGAAGGAAGGG - Intronic
1165872998 19:38986392-38986414 GAAGGAAAGAAAGAAAAGAAGGG - Intergenic
1165873014 19:38986560-38986582 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
1166115551 19:40651600-40651622 GAAGGAAAGAAGGAAAGGAAGGG + Intergenic
1166156914 19:40920467-40920489 GATTGGGAGCAAGTAAAGAATGG + Intergenic
1166353298 19:42211395-42211417 GAAGAAAAGGAAGGAAGGAAGGG + Intronic
1166392126 19:42414278-42414300 AAAGGAAAGAAAGAAAGGAAAGG + Intronic
1166402793 19:42495970-42495992 GATGGAAAGGAAGGAGGGAAAGG - Intergenic
1166551062 19:43666560-43666582 GAAAGAAAGAAAGAAAGGAAAGG - Intronic
1166556745 19:43705181-43705203 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1166908472 19:46132992-46133014 GAGAGAAAGCAAGAAGGGAAGGG + Intergenic
1166938411 19:46348784-46348806 GGTGGAAAGGAAGCCAGGAAAGG + Intronic
1167031172 19:46961972-46961994 GAGAGAAAGGAAGGAAGGAAGGG + Intronic
1167058657 19:47129758-47129780 GAGGGAAAGGAAGGAAGGAAGGG - Intronic
1167129699 19:47576239-47576261 GATCTGAAGGAAGTAAGGAAGGG + Intergenic
1167294708 19:48643125-48643147 GAAGGAAGGGAAGGAAGGAAAGG - Intronic
1167411263 19:49345280-49345302 GAAGGAAGGAAAGGAAGGAAAGG - Intronic
1167815479 19:51876975-51876997 ATTTCAAAGCAAGTAAGGAAGGG + Intronic
1167878171 19:52431456-52431478 GAAAGAAAGGAAGTCAGGAATGG + Exonic
1168143556 19:54405795-54405817 GAAGGAAAGAAAGAAAGGGAAGG - Intergenic
1168158262 19:54490772-54490794 AAAGGAAAGAAAGGAAGGAAGGG - Intergenic
1168503907 19:56916780-56916802 AAGGGAAAGGAAGGAAGGAAGGG - Intergenic
1168503912 19:56916798-56916820 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1168503917 19:56916820-56916842 AAGGGAAAGGAAGGAAGGAAGGG - Intergenic
1168503931 19:56916873-56916895 GAGGAAAAGGAAGGAAGGAAGGG - Intergenic
1168503937 19:56916895-56916917 GAGGGAAAGGAAGGAAGGAATGG - Intergenic
1168725073 19:58576479-58576501 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
925004899 2:434708-434730 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
925004912 2:434845-434867 GAAAGGAAGGAAGTAAGGAAAGG - Intergenic
925244072 2:2364009-2364031 GATGTAAAGCAAGAATGGAATGG + Intergenic
925332349 2:3068474-3068496 GAAGGAAAGAAAGAAAAGAAAGG + Intergenic
925375199 2:3379206-3379228 GAAAGAAATCAAGTAAGCAATGG + Intergenic
925558325 2:5157307-5157329 GAAGAAAAGCAAGAGAGGAAGGG + Intergenic
925767561 2:7251322-7251344 GAAGGAAAGCAAGACAGGACAGG + Intergenic
925947203 2:8876605-8876627 GAGGGAAAGCAAAAAAGAAATGG + Intronic
926159967 2:10481047-10481069 GAAGGAAAGAAAAGAAGGAAGGG - Intergenic
926368218 2:12153174-12153196 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
926542873 2:14203216-14203238 AAGGGAAAGGAAGGAAGGAAGGG + Intergenic
926636608 2:15186804-15186826 GATGGAGAACAAGGAAGGATTGG - Exonic
926974367 2:18498841-18498863 AAAGGAAAGCAAAGAAGGAAAGG - Intergenic
927098492 2:19767240-19767262 CATGTAAAGCAAGGAAGGAGAGG + Intergenic
927657126 2:24958718-24958740 GAATGAATGCAAGGAAGGAAGGG - Intronic
927947755 2:27147563-27147585 AAAGGAAAGGAAGGAAGGAAGGG - Intergenic
928603110 2:32920556-32920578 GATGGAAAGAAGGGAAGGGAAGG - Intergenic
928773733 2:34733315-34733337 GAACGAAAGGAAGGAAGGAAGGG - Intergenic
928794264 2:34997384-34997406 GAAGAAAAGGAAGGAAGGAAGGG - Intergenic
928796771 2:35033062-35033084 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
929317217 2:40493923-40493945 GATAAAAAGGAAGGAAGGAAAGG - Intronic
929505573 2:42525507-42525529 GAAGGAAGGGAAGAAAGGAAGGG - Intronic
929505586 2:42525552-42525574 GAAGGAAAGGAAGGAAGTAAGGG - Intronic
929505593 2:42525579-42525601 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
929505596 2:42525588-42525610 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
929676133 2:43931885-43931907 GAAGGAAAGGAAGGAGGGAAGGG - Intronic
929685160 2:44027049-44027071 GAAAGAAAGGAAGGAAGGAAAGG + Intergenic
929685162 2:44027062-44027084 GAAGGAAAGGAAGAAAGGAAAGG + Intergenic
930146228 2:48007795-48007817 GAGAGAAAGAAAGGAAGGAAAGG - Intergenic
930359569 2:50360426-50360448 AATGGAAAGCAAGAAAGCAAGGG + Intronic
930622542 2:53658939-53658961 GAGGGCAAGAAAGAAAGGAAGGG + Intronic
930726319 2:54685483-54685505 GAAGAAAAGGAAGGAAGGAAGGG - Intergenic
930820763 2:55644065-55644087 GAAAGAAAAAAAGTAAGGAAAGG - Intronic
931181514 2:59906019-59906041 GAGGGAAGGAAAGTAAAGAAGGG + Intergenic
931764108 2:65439387-65439409 GATTGAGAGGAACTAAGGAATGG + Intergenic
931773401 2:65518670-65518692 GAAAGAAAGGAGGTAAGGAAAGG - Intergenic
932859676 2:75276850-75276872 AATGGAAAGAAAGAAAGGCAGGG + Intergenic
932992712 2:76807927-76807949 GAAAGAAAGAAAGAAAGGAAAGG - Intronic
933056477 2:77675159-77675181 TTTGGAAAGCATCTAAGGAATGG - Intergenic
933059966 2:77725130-77725152 GAGGGAAAGGAAGGAAGGGAGGG + Intergenic
933252337 2:80042999-80043021 AAGGGAAAGAAAGGAAGGAAAGG - Intronic
933765225 2:85703570-85703592 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
933919030 2:87026150-87026172 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
933926549 2:87095920-87095942 TTTGGAAAGCATCTAAGGAATGG - Intergenic
934003964 2:87743764-87743786 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
934051468 2:88214784-88214806 GAAGGAAGGAAAGAAAGGAAAGG - Intergenic
934051473 2:88214825-88214847 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
934080471 2:88463442-88463464 GAAGGAAGGAAAGAAAGGAATGG + Intergenic
934249432 2:90336477-90336499 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
934260147 2:91466989-91467011 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
934883515 2:98004769-98004791 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
934883525 2:98004800-98004822 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
934890595 2:98065387-98065409 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
935077963 2:99764191-99764213 GATGCAAAGGAAGTAATGAAAGG - Intronic
935118952 2:100163411-100163433 GATGGAAAACAGCTAAGGAGAGG + Intergenic
935315955 2:101834156-101834178 GAGGGAAGGAAAGGAAGGAAAGG - Intronic
935514366 2:104018383-104018405 GACAGAAAGCAAGTACAGAAGGG - Intergenic
935556853 2:104519481-104519503 GAAAGAAAGAAAGAAAGGAAGGG + Intergenic
936259146 2:110943325-110943347 GAAGGAAAGGAAGGAGGGAAGGG + Intronic
936265970 2:111007009-111007031 AATGGAAAGAAAAGAAGGAAGGG + Intronic
936508798 2:113129326-113129348 GATGGGAAGCAAGTAAGGAGGGG + Intronic
936678690 2:114745657-114745679 GACGGAAAGCAGGAAAGAAATGG - Intronic
936894196 2:117408004-117408026 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
937071355 2:119066128-119066150 GATTGGAGGCAAGCAAGGAAGGG - Intergenic
937308191 2:120885003-120885025 GATGGAAGGCAAGAAATGAATGG - Intronic
937372439 2:121309351-121309373 GGAGGAAAGGAAGGAAGGAAAGG + Intergenic
937875309 2:126820775-126820797 GATGGCTAGCCAGTAAGGAGAGG + Intergenic
938061563 2:128259232-128259254 GAAAGAAAGAAAGAAAGGAAAGG - Intronic
938166730 2:129035586-129035608 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
938511249 2:131947410-131947432 GAGAGAAAGAAAGGAAGGAAGGG - Intergenic
938552913 2:132397245-132397267 GAGGGCAAGCAAGCAAGAAAGGG - Intergenic
938693006 2:133809513-133809535 GATGAAAGGGAAATAAGGAAAGG + Intergenic
938872470 2:135494362-135494384 GAAAGAAAGAAAGGAAGGAAAGG + Intronic
939396452 2:141636981-141637003 GTTGGAAAGAAAGTAAAGAGAGG + Intronic
939584245 2:143987673-143987695 GCTGGGAAGCAAGGGAGGAATGG - Intronic
939747361 2:145992461-145992483 GATAGAAAGCAAGAAAGAGAGGG + Intergenic
940045594 2:149406556-149406578 AATGGAAAACAAATAAGGCAGGG - Intronic
940425630 2:153528001-153528023 GAAGGAAAGCAAGAAGGGAGGGG + Intergenic
940532666 2:154899551-154899573 AATGGAAAGTAAATAAGGAATGG - Intergenic
940656135 2:156489860-156489882 GAGGGGAAGGAAGGAAGGAAGGG - Intronic
940832422 2:158482313-158482335 CTTGGAAAGGAAGGAAGGAAGGG - Intronic
941153197 2:161940675-161940697 GGTGGAAAGCAATTAAGGGGAGG + Intronic
941451537 2:165666166-165666188 GAGAGAAAGGAAGGAAGGAAGGG + Intronic
941763597 2:169271833-169271855 GAGTGAAAGCAGGGAAGGAAGGG + Intronic
942002060 2:171657545-171657567 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
942347121 2:175015137-175015159 GAGGGAAAGGAAGAAGGGAAGGG + Intergenic
942413386 2:175734289-175734311 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
942575623 2:177360693-177360715 AAGGGAAAACAAGAAAGGAAGGG - Intronic
942615030 2:177782820-177782842 GAAGGAAAGAAAGAAAAGAAAGG - Intronic
942725236 2:178999347-178999369 GATGGAAATAGAGAAAGGAAAGG - Intronic
942844989 2:180413270-180413292 GAAGGAAAGAAAGAAAGAAAAGG + Intergenic
942849951 2:180472728-180472750 GAAGGAAAGGAAGGAAGGGAGGG - Intergenic
942849953 2:180472732-180472754 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
942946444 2:181679521-181679543 GATGGAAGGCAAGAAAAGAAAGG - Intronic
943003409 2:182358956-182358978 GAAGGAAAGGAAGGAAGGGAAGG - Intronic
943003410 2:182358960-182358982 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
943016474 2:182516795-182516817 GAGAGAAAGGAAGGAAGGAAAGG + Intronic
943207937 2:184925353-184925375 AATGGAAACCAAGAAAGGATAGG - Intronic
943214252 2:185010331-185010353 TGTGGAAAGCCACTAAGGAAAGG + Intergenic
943499181 2:188665969-188665991 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
943499188 2:188665992-188666014 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
944352198 2:198742160-198742182 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
944651751 2:201837429-201837451 GAAGGGAAGGAAGGAAGGAAAGG + Intronic
944787785 2:203090956-203090978 AAAGGAAAGGAAGAAAGGAAAGG + Intronic
945058710 2:205889885-205889907 GAAGGAAAGAAGGGAAGGAAGGG + Intergenic
945063109 2:205925617-205925639 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
945471027 2:210228310-210228332 GATTGAAAGAAAGGAAGGATGGG - Intergenic
945564644 2:211382249-211382271 GAAGGAATGCGAGTAAGGATTGG - Exonic
945593751 2:211767016-211767038 GGTGTAAAGCAAGTAACCAATGG + Intronic
945799338 2:214406170-214406192 GAAGGAAAGTAAGTATTGAAAGG + Intronic
945877092 2:215289488-215289510 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
945911189 2:215651466-215651488 GAAGGAAGGCAGGAAAGGAAGGG + Intergenic
945911213 2:215651535-215651557 GAGGGAAAGGAAGGAGGGAAAGG + Intergenic
946124990 2:217554871-217554893 GATGGAGAGATTGTAAGGAAGGG + Intronic
946338350 2:219053442-219053464 GATGGAGGGAAAGTAAAGAAGGG + Intergenic
946514333 2:220394993-220395015 GATGGAAAGAAGTCAAGGAATGG - Intergenic
946967753 2:225055801-225055823 GCTGGGAAGCAAGGCAGGAAGGG + Intergenic
947137955 2:226993943-226993965 GAGGGAAAGCAAGTAAACAGTGG - Intronic
947148024 2:227086409-227086431 AAGGGAAAGAAAGAAAGGAAAGG - Intronic
947159071 2:227193815-227193837 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
947661163 2:231869651-231869673 GATGGAAAGGGGGAAAGGAAGGG - Intergenic
948938951 2:241186756-241186778 GAGGGAAAGGAAGGAAGGGAGGG - Intergenic
1168885194 20:1245966-1245988 GATAGGAAGCAAGGAGGGAAGGG + Intronic
1168899618 20:1352143-1352165 GAAGGAAGGGAAGGAAGGAAGGG - Intronic
1168899643 20:1352221-1352243 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1168973192 20:1945007-1945029 GGTGGGAAGGAAGAAAGGAAGGG + Intergenic
1169305071 20:4482630-4482652 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1169336888 20:4763998-4764020 GATGGAAAGCAAGGAAATAGAGG + Intergenic
1169467259 20:5852393-5852415 GAGGGAAAGGAAGGAAGGAAAGG - Intronic
1169476758 20:5938889-5938911 GAAGGGAAGGAAGGAAGGAAGGG - Intronic
1169851310 20:10054501-10054523 GAGGGAAAGAAAGTACAGAAGGG + Exonic
1169966306 20:11221522-11221544 GATGGCAAGCAAGCAAGAACTGG + Intergenic
1170061809 20:12266773-12266795 GAAGGAAGGCAAGGAGGGAAGGG + Intergenic
1170132481 20:13036275-13036297 GGTGGAAAGGAAGGAAGGAGAGG - Intronic
1170481954 20:16774793-16774815 GAAAGAAAGAAAGGAAGGAAAGG + Intergenic
1170541394 20:17391960-17391982 GAAGGAAAGGAAGGAAGGGAAGG + Intronic
1170541400 20:17391983-17392005 GAAGGAAGGAAAGGAAGGAAAGG + Intronic
1171022147 20:21595392-21595414 GATGGAAGGAAGGTACGGAAGGG - Intergenic
1171465700 20:25326196-25326218 GAGGGAAAGAAAGGAAAGAAAGG + Intronic
1171913328 20:30987632-30987654 AATGGAAAGCAAAAAAGGCAGGG + Intergenic
1172424528 20:34846290-34846312 GAAAGAAAGAAAGAAAGGAAGGG - Intronic
1172711127 20:36924316-36924338 AAGGGAAAGAAAGGAAGGAAAGG + Intronic
1172711131 20:36924329-36924351 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
1172762928 20:37334553-37334575 GAAGGAAAGAAAGGAAAGAAAGG + Intergenic
1172868203 20:38116201-38116223 AATGGGAAGGAAGGAAGGAAGGG - Intronic
1173206250 20:40996466-40996488 GAAGGAAGGAAAGAAAGGAAAGG + Intergenic
1173281527 20:41632632-41632654 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
1173313142 20:41918132-41918154 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
1173364008 20:42368988-42369010 AAAGGAAAGGAAGGAAGGAAAGG - Intronic
1173564682 20:44030283-44030305 GATGGAAAGCAAGAGATGGAGGG - Intronic
1173636035 20:44558733-44558755 AATGAAAAGAAAGGAAGGAAGGG - Intronic
1173894184 20:46537858-46537880 AGTGGAAACCAAGTAAGGATCGG + Intergenic
1173900787 20:46587424-46587446 GAAGGAAAGCGGGTGAGGAAAGG - Intronic
1173928919 20:46802071-46802093 AAAGGAAAGAAAGTAGGGAAAGG - Intergenic
1173930623 20:46814972-46814994 GATGTAAATAAAGGAAGGAATGG - Intergenic
1174185711 20:48704526-48704548 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1174214667 20:48907103-48907125 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
1174666984 20:52267736-52267758 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1174701151 20:52610887-52610909 GAAGGAAAGAGAGGAAGGAAGGG - Intergenic
1174701206 20:52611115-52611137 GAGGGAAAGGAAGGAAGGAAGGG - Intergenic
1174767557 20:53268306-53268328 GATGGGAACCAGTTAAGGAATGG + Intronic
1174772064 20:53309451-53309473 GAGGAAAAGAAAGGAAGGAAAGG + Intronic
1174800753 20:53561095-53561117 GAAGGAAAGAAAGAAAGGGAGGG + Intergenic
1174879365 20:54261512-54261534 GATGGAAAACAAGCAAGGTGAGG - Intergenic
1174913456 20:54631438-54631460 GAAAGAAAGGAAGGAAGGAAGGG + Intronic
1175151632 20:56939747-56939769 GAAGGAAAGAAAGAAAGGAAAGG + Intergenic
1175392462 20:58635955-58635977 GAAGGAAGGGAAGGAAGGAAAGG + Intergenic
1176167858 20:63683430-63683452 GCTGGGAAGGAAGGAAGGAACGG + Intronic
1176703474 21:10089029-10089051 GGTAGAAAGCCAGGAAGGAAAGG + Intergenic
1177121218 21:17139275-17139297 GAGAGGAAGCAAGGAAGGAAAGG + Intergenic
1177347960 21:19898755-19898777 GAAGGAAAGGAAGGAAGAAAGGG - Intergenic
1177357393 21:20027044-20027066 GAAGGAAAGAAAGAAAGAAAGGG + Intergenic
1177414009 21:20771122-20771144 GATTGAAATCAAATAAGAAATGG + Intergenic
1177497131 21:21903798-21903820 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
1177524894 21:22278322-22278344 AATTGAAGGCAAGTAAGGACAGG + Intergenic
1177673138 21:24260227-24260249 GCTGGCTAGCTAGTAAGGAAAGG - Intergenic
1177830245 21:26130804-26130826 GATAGTAAGGAAGGAAGGAAGGG - Intronic
1177948028 21:27497089-27497111 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1178057059 21:28811337-28811359 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1178129888 21:29560481-29560503 GAAGGAAAGAAAGAAAGAAAGGG - Intronic
1178806718 21:35845500-35845522 CATGAAAAGCCAGTTAGGAAGGG - Intronic
1178985899 21:37302800-37302822 GATCTAAAGCAAGTATGGACTGG - Intergenic
1179075749 21:38120028-38120050 GGTTGAAAGTAAGTAAGGGATGG + Intronic
1179089697 21:38253163-38253185 TGGGGAAAGCAAGTCAGGAAGGG - Intronic
1179305797 21:40153136-40153158 GTTGGAAAGCAGGTAAGGGGAGG - Intronic
1179462356 21:41545803-41545825 GAGGGAAAGGAGGGAAGGAAGGG + Intergenic
1179508232 21:41855926-41855948 GAAGGAAAGGAAGGAAGGGAGGG - Intronic
1179508234 21:41855930-41855952 GAGGGAAGGAAAGGAAGGAAGGG - Intronic
1179508245 21:41855960-41855982 GAAGGAAAGGAAGGAAGGGAGGG - Intronic
1179508247 21:41855964-41855986 GAGGGAAGGAAAGGAAGGAAGGG - Intronic
1179508259 21:41855995-41856017 GAAGGAAAGGAAGGAAGGGAGGG - Intronic
1179508261 21:41855999-41856021 GAGGGAAGGAAAGGAAGGAAGGG - Intronic
1179508273 21:41856030-41856052 GAAGGAAAGGAAGGAAGGGAGGG - Intronic
1179508275 21:41856034-41856056 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
1179891308 21:44336390-44336412 GATAGAAAGCAAGGAAAGGATGG + Intronic
1179969942 21:44830266-44830288 GATGGACACCAAGTAACCAATGG - Intergenic
1180079165 21:45478578-45478600 GAAGGAAAGGAAGTGAGAAAAGG + Intronic
1180246575 21:46552118-46552140 TGTGGAAAACAAGAAAGGAAAGG - Intronic
1180392053 22:12293342-12293364 GAAGGAAAGAAAGAAAGAAAGGG - Intergenic
1180489974 22:15835191-15835213 GATGGATAGACAGTAAAGAAGGG - Intergenic
1180525416 22:16254621-16254643 GAAGGAAAGAAAGAAAGAAAAGG + Intergenic
1181389796 22:22571941-22571963 GAGAGAAAGAAAGGAAGGAAGGG + Intergenic
1181391382 22:22584892-22584914 GAAGGAAAGGAAAAAAGGAAAGG - Intergenic
1181469658 22:23130016-23130038 GAAGGAAAGAAAGAAAGGGAAGG + Intronic
1181497935 22:23298524-23298546 GAAGGAAGGGAAGGAAGGAAGGG - Intronic
1181602501 22:23960771-23960793 GATGGAAAGAAAATACTGAATGG - Intronic
1181606012 22:23980536-23980558 GATGGAAAGAAAATACTGAATGG + Intronic
1181961794 22:26627534-26627556 GAAGGAAAGAAAGAAAGAAAAGG - Intronic
1182231845 22:28843684-28843706 GAAGGAAAGAAAGGAAAGAAAGG + Intergenic
1182231847 22:28843693-28843715 AAAGGAAAGAAAGGAAGGAAAGG + Intergenic
1182466800 22:30521980-30522002 GAAGGAAAGGAAAGAAGGAAGGG - Intergenic
1182741676 22:32572348-32572370 GGTGGAAGGGAAGTAAGGGAAGG - Intronic
1182800346 22:33026957-33026979 GAAGGAAAGAAAATAAAGAAGGG - Intronic
1182825677 22:33262767-33262789 GAAGGGAAGGAAGGAAGGAAAGG - Intronic
1182879643 22:33722376-33722398 GAAGGAAAGGAAGGAAAGAAGGG + Intronic
1182879971 22:33724904-33724926 GAAGGAAATAAAGGAAGGAAAGG + Intronic
1183162811 22:36126405-36126427 GAGGGAGAGGAAGGAAGGAAAGG - Intergenic
1183162888 22:36126713-36126735 GAGGGAGAGGAAGGAAGGAAAGG - Intergenic
1183162894 22:36126735-36126757 GAGGGAGAGGAAGGAAGGAAAGG - Intergenic
1183321545 22:37167868-37167890 GATGGGAAGCAAGGGAGGAAGGG + Intronic
1183680436 22:39325573-39325595 GAAGGAAGGAAAGAAAGGAAAGG + Intergenic
1183680448 22:39325643-39325665 GAAGGGAAGGAAGGAAGGAAAGG + Intergenic
1183959633 22:41403698-41403720 GATGGAGAGGAAGAAAGGCAAGG - Intergenic
1184459570 22:44629362-44629384 GAAAGAAAGAAAGAAAGGAAGGG + Intergenic
1184480313 22:44742910-44742932 GAAGGAAGGAAAGGAAGGAAGGG + Intronic
1184480315 22:44742914-44742936 GAAGGAAAGGAAGGAAGGGAGGG + Intronic
1184804285 22:46782462-46782484 GATGGAAGGGAGGAAAGGAAGGG - Intronic
1185133634 22:49055903-49055925 GATGGAGAGAAAGAAAGGGAGGG - Intergenic
1185135710 22:49071001-49071023 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1185135759 22:49071218-49071240 GAAGGAATGGAAGGAAGGAAGGG - Intergenic
1203302756 22_KI270736v1_random:88492-88514 GGTGGAATGCAAGAAAGGAATGG + Intergenic
949257453 3:2065302-2065324 GAAGGAAGGAAAGAAAGGAAAGG + Intergenic
949271500 3:2223169-2223191 AATGGAGAGCCAGTAAGTAAAGG + Intronic
949278625 3:2319445-2319467 GATGGAAGGCGAGGCAGGAAAGG - Intronic
950244104 3:11399539-11399561 GGAGGAAAGGAAGGAAGGAAAGG - Intronic
950462158 3:13131019-13131041 GAAGGGAAGGAAGGAAGGAAAGG + Intergenic
950491789 3:13309689-13309711 GCTTGAAAGCAAGGAAGCAAGGG + Intergenic
950903635 3:16518098-16518120 GGAGAAAAGCAAGGAAGGAAAGG + Intergenic
951144318 3:19208697-19208719 TGTGGAAAGCATTTAAGGAAAGG + Intronic
951409792 3:22348666-22348688 GAAAGAAAGAAAGAAAGGAAGGG + Intronic
951479822 3:23148497-23148519 GAAGGAAAGGAAGGAAAGAAAGG + Intergenic
951479825 3:23148506-23148528 GAAGGAAAGAAAGGAAGGAAGGG + Intergenic
951620680 3:24598786-24598808 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
952059970 3:29495932-29495954 CATGGAAATCAAGCAAGTAAAGG + Intronic
952358531 3:32606480-32606502 GAAGGAAGGGAAGGAAGGAAAGG + Intergenic
952429554 3:33209563-33209585 GAAGGAAAGAAAGAAAGAAAAGG - Intronic
952507234 3:34018110-34018132 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
952507235 3:34018114-34018136 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
952547609 3:34437420-34437442 GCTGAAAAGAAAGCAAGGAAAGG - Intergenic
952569204 3:34694374-34694396 AAAGGAAAGGAAGGAAGGAAAGG - Intergenic
952709182 3:36412267-36412289 GAAGGAAAGAAAGAAAGGGAGGG + Intronic
953163503 3:40443619-40443641 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
953203899 3:40803660-40803682 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
953442236 3:42928253-42928275 TATGGATAGAAAGAAAGGAAGGG + Intronic
953473632 3:43187280-43187302 GAAGGAAAGAAAGGAAAGAAAGG + Intergenic
953625464 3:44567261-44567283 GAAGGAAGGGAAGGAAGGAAAGG + Intronic
953625970 3:44571476-44571498 AAGGAAAAGCAAGTAGGGAATGG - Exonic
953692671 3:45133157-45133179 GGTTGAAAGCCAGCAAGGAAAGG + Intronic
954336854 3:49923423-49923445 GAAAGAAAGAAAGAAAGGAAGGG + Intronic
954556634 3:51522381-51522403 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
954602316 3:51878989-51879011 GAAGGAAAGAAAAGAAGGAAGGG + Intergenic
955087769 3:55719944-55719966 GAAGGAAAGAAAGGAAAGAAAGG - Intronic
955623863 3:60895631-60895653 GAGGGAAAGGAAGGAAAGAAGGG - Intronic
955874599 3:63476223-63476245 GAAGGGAAGGAAGGAAGGAAAGG + Intronic
955874642 3:63476356-63476378 GAAGGGAAGGAAGGAAGGAAAGG + Intronic
956190304 3:66601749-66601771 GAGAGAAAGAAAGGAAGGAAGGG - Intergenic
956538333 3:70304917-70304939 GCTGGATAGAAAGGAAGGAAGGG - Intergenic
956565383 3:70631318-70631340 GAGAGAAAGAAAGAAAGGAAAGG + Intergenic
956673589 3:71714298-71714320 GAAGGAACGAAAGAAAGGAAAGG + Intronic
956790822 3:72678752-72678774 GATGGAAAGTAAATAATGCAGGG + Intergenic
957036527 3:75298474-75298496 GAAGGAAAGAAAGGAAGGAAGGG + Intergenic
957168329 3:76704599-76704621 CATGGAAAGGAAGTAAAGGAAGG - Intronic
957520361 3:81311291-81311313 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
957699723 3:83693442-83693464 GATGGAAAGAAGGGAAAGAAGGG - Intergenic
957791750 3:84950620-84950642 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
957821609 3:85383817-85383839 GGTGGAAATCAACAAAGGAATGG - Intronic
957914764 3:86674318-86674340 AAAGGAAAGCAAGTCAGCAAAGG - Intergenic
957935781 3:86939810-86939832 GATGGAAGGAAACTAAGCAAAGG + Exonic
958022983 3:88018377-88018399 GAAGGAAAGAAAGAAAGAAAAGG + Intergenic
958052890 3:88370562-88370584 GAGAGAAAGAAAGGAAGGAAGGG - Intergenic
958111981 3:89159935-89159957 GAAGGAAAAGAAGGAAGGAAGGG - Intronic
958117128 3:89234827-89234849 GAAGGAAGGAAAGAAAGGAAAGG - Intronic
958533543 3:95365953-95365975 GATGGCAACCCAGTAAGAAAGGG - Intergenic
958656939 3:97014445-97014467 GAAGGAAAGAAGGAAAGGAAAGG - Intronic
959638099 3:108598661-108598683 GATGGTAATCAAATAGGGAATGG - Intronic
960108348 3:113821497-113821519 GAGAGAAAGAAAGGAAGGAAGGG - Intergenic
960910503 3:122644549-122644571 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
960928949 3:122824688-122824710 AAAGGAAAGGAAGAAAGGAAGGG - Intronic
961080261 3:124020929-124020951 GAAGGAAAGAAAGGAAGGAAGGG + Intergenic
961340102 3:126212198-126212220 GAAGGAAAGGAGGGAAGGAAAGG + Intergenic
961396810 3:126599272-126599294 AATGGAAGGAAAGTAGGGAATGG - Intronic
961584594 3:127911518-127911540 GGTGGAAAACAAGGAGGGAATGG - Intergenic
961878406 3:130042266-130042288 GATGCAAAACGAGTGAGGAATGG - Intergenic
962376752 3:134864661-134864683 TATGGAAAGCAAGTAGAAAACGG - Intronic
962614883 3:137115668-137115690 GATGGAAAGCATGAAAAAAAGGG - Intergenic
962632293 3:137290804-137290826 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
962632296 3:137290813-137290835 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
962632297 3:137290817-137290839 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
962649622 3:137475554-137475576 GATAGAAAGGAAGGAAGGGAGGG - Intergenic
962922232 3:139960600-139960622 GATGGAAGGCAGAGAAGGAAAGG - Intronic
963064262 3:141251213-141251235 GCTGGAAGGCAATCAAGGAATGG + Intronic
963237148 3:142967040-142967062 GAAGGAAGGGAAGGAAGGAAAGG + Intronic
963253766 3:143123589-143123611 AATGGGAAGCAAGTAAGAAAAGG - Intergenic
963775999 3:149441136-149441158 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
963842324 3:150120426-150120448 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
963935077 3:151044007-151044029 GAGGGAAAAAAAATAAGGAAAGG - Intergenic
963997937 3:151732824-151732846 GATGAAAAGCAAGTGAGAGATGG + Intergenic
964019784 3:151995915-151995937 GAAGTAAAGGAAGGAAGGAAGGG - Intergenic
964032802 3:152157420-152157442 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
964178743 3:153857598-153857620 AAAGGAAAGAAAGGAAGGAAGGG + Intergenic
964492439 3:157251127-157251149 GAAGGAAAGAAAGAAAGGAAAGG - Intergenic
964516427 3:157513727-157513749 GGAGGAAAGGAAGGAAGGAAGGG + Intronic
964604297 3:158542658-158542680 GATGGAAAGGTTGGAAGGAATGG + Intronic
964652610 3:159028305-159028327 GATGGAACGAAAAAAAGGAAGGG + Intronic
964824146 3:160806853-160806875 GAGGGAAGGAAAGGAAGGAAAGG + Intronic
965220330 3:165919328-165919350 AAGGGAAAGTAAGTAAGGGATGG - Intergenic
965230404 3:166043790-166043812 GAAGAAAAGAAAGTAAGCAAAGG + Intergenic
965501023 3:169456695-169456717 GATGGAAAGCACCTCTGGAATGG - Intronic
965502456 3:169472699-169472721 GAAGGAAAGGAAGAAAGGGAGGG + Intronic
965772214 3:172193190-172193212 GATGGAAAGGAAGGGAGGGAGGG - Intronic
965899832 3:173625204-173625226 AATGGTAAAGAAGTAAGGAAAGG + Intronic
966054481 3:175667253-175667275 GAAAGAAAGAAAGGAAGGAAGGG + Intronic
966055025 3:175676739-175676761 GATTAAAAGGAAGTCAGGAAGGG - Intronic
966130112 3:176627797-176627819 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
966140609 3:176752270-176752292 GAAGGAAAGAGAGAAAGGAAGGG + Intergenic
966170050 3:177069756-177069778 AAAGGAAAGAAAGGAAGGAAAGG + Intronic
966861317 3:184232405-184232427 GATGGAAGGAAAGAAAGAAAGGG - Intronic
967044015 3:185719845-185719867 GAAGGAAGGAAAGGAAGGAAAGG + Intronic
967283537 3:187846094-187846116 GAAGGAAAGAAAGGAAGGAAGGG - Intergenic
967350745 3:188511255-188511277 GAGGGAAAGGAAGGAGGGAAGGG - Intronic
967433033 3:189410763-189410785 GAAGGAAGGAAAGAAAGGAAAGG - Intergenic
967532569 3:190566056-190566078 GATGGAGAGAAAGGAAAGAAGGG - Intronic
967854953 3:194110499-194110521 GCAAGAAAGCAAGGAAGGAAGGG + Intergenic
968147467 3:196311496-196311518 GAAGAAAAGGAAGTAACGAATGG + Intronic
968206938 3:196811313-196811335 GAGGGAAGGGAAGGAAGGAAAGG - Intronic
968222488 3:196948866-196948888 GAAGGAAGGGAAGGAAGGAAGGG - Intronic
968339331 3:197941505-197941527 GAGAGAAAGGAAGGAAGGAAGGG - Intronic
968366881 3:198192382-198192404 GAGGGAAGGAAAGGAAGGAAGGG - Intergenic
968396646 4:244423-244445 GAGGGAAATCAAGAAAGAAAAGG + Intergenic
968678143 4:1896705-1896727 GAAGGAAAGGAAGGAAGGAGAGG - Intronic
968820424 4:2845882-2845904 CATGGAAGGAAAGAAAGGAAGGG - Intronic
969051366 4:4375516-4375538 GGAGGAAAGAAAGAAAGGAAGGG - Intronic
969481590 4:7449350-7449372 GAGAGAAAGGAAGGAAGGAAAGG - Intronic
969581080 4:8065924-8065946 GAAGGAAAGGAAGGAAAGAAGGG + Intronic
969586149 4:8094940-8094962 GAGGGAAAGGAAGGGAGGAAAGG - Intronic
970018844 4:11543935-11543957 GATTGGAAGAAAGTAAGGCAGGG - Intergenic
970108740 4:12614405-12614427 AAAGGAAAGGAAGGAAGGAAAGG - Intergenic
970398686 4:15697253-15697275 GGTGGAAAGAAAATGAGGAAGGG + Intronic
970434698 4:16022131-16022153 GAGGGAAAGAAAGAAAGGGAGGG + Intronic
970462913 4:16293499-16293521 GAAGAAAAGCATTTAAGGAAAGG + Intergenic
970491692 4:16581924-16581946 GAAAGAAAGAAAGAAAGGAAGGG + Intronic
970534650 4:17018193-17018215 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
970572036 4:17392852-17392874 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
970688642 4:18596897-18596919 GCAGGAAAGGAAGGAAGGAAAGG + Intergenic
970693280 4:18644448-18644470 GAGGCAAAGGAAGGAAGGAAGGG + Intergenic
971045546 4:22801626-22801648 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
971663387 4:29449973-29449995 GAGGGGAAGGAAGGAAGGAAGGG + Intergenic
971771347 4:30900817-30900839 CATGGAAATAAAGTCAGGAATGG + Intronic
971849122 4:31960498-31960520 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
972551062 4:40134887-40134909 GAGAGAAAGGAAGGAAGGAAGGG - Intronic
972704451 4:41528213-41528235 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
972792210 4:42384035-42384057 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
973157677 4:46977252-46977274 GAAGAAAAGGAAGGAAGGAAGGG + Intronic
973319712 4:48797555-48797577 GAAGGAAAGAAAGAAAGAAAAGG + Intergenic
973708937 4:53607119-53607141 AAGAGAAAGAAAGTAAGGAAAGG + Intronic
973835617 4:54806422-54806444 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
974068906 4:57106365-57106387 GATGGAAAGGAAGTGAAGGAGGG + Intronic
974468335 4:62286431-62286453 AAAGGAAAGCAAGTACAGAATGG + Intergenic
974685264 4:65218670-65218692 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
974685267 4:65218683-65218705 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
974685275 4:65218730-65218752 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
974685287 4:65218786-65218808 GAAGGAATGGAAGGAAGGAAGGG + Intergenic
974685291 4:65218799-65218821 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
974702151 4:65465583-65465605 AAAGGAAAGAAAGGAAGGAAAGG + Intronic
974845673 4:67348614-67348636 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
975226224 4:71876171-71876193 GAAGTAAAGGAAGGAAGGAAGGG - Intergenic
975377236 4:73659859-73659881 AATGAAAAGCAATTAAGCAATGG - Intergenic
975440163 4:74400920-74400942 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
975455937 4:74589710-74589732 GAAGGGAAGGAAGCAAGGAAGGG + Intergenic
975504410 4:75122566-75122588 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
975504468 4:75122962-75122984 GAAGGAAAGAAAGAAGGGAAGGG + Intergenic
975858966 4:78655682-78655704 GACGGGAAGGAAGGAAGGAACGG + Intergenic
975971424 4:80042840-80042862 GAGGGAAAGAAACTAAGAAAAGG - Intronic
976044847 4:80933160-80933182 GAAAGAAAGAAAGAAAGGAAAGG - Intronic
976081140 4:81356186-81356208 GACGGAAAGAAAGGCAGGAAGGG + Intergenic
976164595 4:82240657-82240679 GAGGGAAAGGAAGGAAGGGAGGG + Intergenic
976336333 4:83892240-83892262 GACTGAAAGAGAGTAAGGAATGG - Intergenic
976580957 4:86736539-86736561 CATGGAAAGAAAGAAAGGCAAGG + Intronic
976861321 4:89670307-89670329 GAGGGAAGGAAAGGAAGGAAAGG - Intergenic
977166701 4:93708747-93708769 GAAGGAAAGAAAGGAAAGAAAGG - Intronic
977168703 4:93732825-93732847 TATGGAGAGAAGGTAAGGAAAGG - Intronic
977287040 4:95120807-95120829 CTTGAAAAGGAAGTAAGGAAGGG - Intronic
977406708 4:96608698-96608720 AATGGAAAGAAAGTAAGTGATGG - Intergenic
977423011 4:96827725-96827747 GATGGAATGCAATTATGGATGGG - Intergenic
977763611 4:100771232-100771254 TAAGGAAAGGAAGGAAGGAAGGG + Intronic
977763614 4:100771245-100771267 GAAGGAAGGGAAGGAAGGAAAGG + Intronic
977807770 4:101323166-101323188 GAGGGCAAGCAAGGGAGGAATGG - Intronic
978422967 4:108553687-108553709 GAAGGAAAGAAAGGAAGGGAAGG - Intergenic
978422968 4:108553691-108553713 GAAGGAAGGAAAGAAAGGAAGGG - Intergenic
978598189 4:110401373-110401395 GAAGGAAAGAAAGAAATGAAAGG - Intronic
979234436 4:118384100-118384122 GAAGGGAAGGAAGAAAGGAAGGG - Intergenic
979333039 4:119438517-119438539 GAGGGAAGGAAAGGAAGGAAGGG + Intergenic
979333040 4:119438521-119438543 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
979333042 4:119438530-119438552 GAAGGAAGGGAAGGAAGGAAAGG + Intergenic
979333045 4:119438539-119438561 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
979388444 4:120098491-120098513 TAGGGATAGCAAGTGAGGAAAGG + Intergenic
979431483 4:120638348-120638370 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
979461390 4:120988514-120988536 AATGGAAAGCAAAAAAGGCAGGG - Intergenic
979492008 4:121338909-121338931 GATGGAAAGCAAGTAAGGAAAGG - Intronic
979520929 4:121665761-121665783 GGAGGAAAGGAAGGAAGGAAGGG - Intergenic
979749645 4:124262964-124262986 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
979749712 4:124264006-124264028 TAAGGAAAGCAAGGCAGGAAAGG + Intergenic
979876563 4:125898845-125898867 GAAGGAAAGAAGGAAAGGAAAGG - Intergenic
980375692 4:131945385-131945407 GGTAGAAAGCCAGGAAGGAAAGG + Intergenic
980888939 4:138793599-138793621 GATGGAAAGGAAGGGAGGGATGG + Intergenic
981035827 4:140167915-140167937 GAGAGAAAGGAAGAAAGGAAGGG + Intergenic
981049189 4:140294002-140294024 GATGGAAAGAAGTTAAAGAAGGG + Intronic
981316365 4:143343539-143343561 TGTGGAATGCAAGGAAGGAAAGG + Intronic
981403174 4:144338086-144338108 GTGGGAAAGAAAGGAAGGAAGGG - Intergenic
981440800 4:144779530-144779552 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
981457234 4:144967066-144967088 GATGGTAAGCATGTAATAAATGG - Intergenic
981624726 4:146742618-146742640 GAAGGAAACGAAGGAAGGAAGGG - Intronic
981654598 4:147099141-147099163 TATGATCAGCAAGTAAGGAAAGG + Intergenic
981726406 4:147852113-147852135 GATGGGGAGCAAGTCATGAATGG - Intronic
981813997 4:148807638-148807660 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
982013058 4:151125512-151125534 GAAAGAAAGAAAGGAAGGAAAGG + Intronic
982509314 4:156261667-156261689 GAAGGAAAATAAGAAAGGAAGGG - Intergenic
982515282 4:156339119-156339141 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
982708615 4:158737337-158737359 GAAGGAAAGGAGGGAAGGAAGGG + Intergenic
982804748 4:159749284-159749306 AAAGGAAAGGAAGAAAGGAAAGG - Intergenic
982892652 4:160875722-160875744 GAAAGAAAGAAAGAAAGGAATGG - Intergenic
982983144 4:162166758-162166780 GATAGAAAGTAAGAAAGTAATGG - Intergenic
983030935 4:162801147-162801169 TATGGAAAGCAAGAAAAGCAGGG - Intergenic
983089828 4:163490104-163490126 GAAGAAAAGGAAGGAAGGAAGGG - Intergenic
983922185 4:173357966-173357988 GATGGTAAGCAATGCAGGAAGGG + Intergenic
983966177 4:173813789-173813811 GATTGAAAGAAAGTGAAGAAAGG - Intergenic
984149359 4:176107819-176107841 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
984173298 4:176386401-176386423 CAAGGCAAGCAGGTAAGGAAAGG + Intergenic
984607659 4:181804071-181804093 GAAAGAAAGAAAGAAAGGAAGGG + Intergenic
984767057 4:183407817-183407839 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
985054781 4:186026708-186026730 GATGAAAGGGAAGGAAGGAAGGG - Intergenic
985304797 4:188527515-188527537 GAGAGAAAGAAAGAAAGGAAAGG + Intergenic
986241088 5:5960780-5960802 AAAGGAAAGAAAGGAAGGAAGGG - Intergenic
986356825 5:6936919-6936941 GAAAGAAAGAAAGGAAGGAAAGG + Intergenic
986468456 5:8050335-8050357 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
986589356 5:9353085-9353107 AAAGGAAAGGAAGGAAGGAAAGG + Intronic
986589431 5:9353394-9353416 AAGGGAAAGAAAGGAAGGAAAGG + Intronic
986622757 5:9692600-9692622 ACTGCAAAGCAAGTGAGGAAGGG - Intronic
986636070 5:9823620-9823642 GAGGGAAAGGGAGGAAGGAAGGG + Intergenic
986636084 5:9823660-9823682 GAGGGAAAGGAAGGAAGGGAAGG + Intergenic
986656152 5:10014838-10014860 AATGGAAAGCAAATAAAGCAGGG - Intergenic
986830862 5:11576211-11576233 GATTGAAAGCAAGTATGAACAGG - Intronic
986876492 5:12117238-12117260 GATAAAAAGAAAGTAAGAAAAGG + Intergenic
986991161 5:13554495-13554517 GAGGGAAAGAAAGGAAAGAAGGG - Intergenic
987135320 5:14894585-14894607 GATGGATAGGAAGTGAGGAGGGG + Intergenic
987223492 5:15815232-15815254 GATTGAAAGGAATGAAGGAAGGG + Intronic
987294978 5:16541789-16541811 GAAGGAAGGAAAGGAAGGAAGGG + Intronic
987376363 5:17239036-17239058 GATTGATATCAAGTAAGGAAGGG - Intronic
987602950 5:20095551-20095573 GAAGGAAAGAAAGGAAAGAAAGG + Intronic
987696974 5:21344680-21344702 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
987890352 5:23868003-23868025 GGAGGAAAGAAAGTAAAGAAAGG - Intergenic
988861158 5:35281505-35281527 AGTGGAAAGAAAGCAAGGAAGGG - Intergenic
988937687 5:36104976-36104998 GATTGAAAATAAGTAAGTAAAGG - Intronic
989278006 5:39610969-39610991 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
989414581 5:41159071-41159093 CATGGAAAACAAGTAAGGCCGGG - Exonic
989427413 5:41312670-41312692 GAAGGAAAGGAAGAAAGGAAGGG - Exonic
989546801 5:42683696-42683718 GGTGGAAGGGAAGAAAGGAAGGG + Intronic
989609539 5:43277979-43278001 GAAGAAAAGGAAGGAAGGAAGGG - Intronic
989623891 5:43411500-43411522 GAAGGAAAGGAAGAAAGGAAAGG - Intronic
989663727 5:43826782-43826804 GAGAGAAAGAAAGGAAGGAAAGG - Intergenic
989710407 5:44389815-44389837 GCTGGAAAGCAAGTGAGAAAGGG - Intergenic
989774256 5:45183978-45184000 GAGGGAGAGCAAGTAAGAACTGG - Intergenic
990249721 5:53901165-53901187 GATTGACAGAAAGGAAGGAAAGG - Intronic
990349263 5:54899538-54899560 TATGGAAGCCAAGAAAGGAAAGG - Intergenic
990491821 5:56310269-56310291 GTTGGAAACCAAGGAAGGAAAGG + Intergenic
990566108 5:57031168-57031190 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
990874862 5:60473240-60473262 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
990886039 5:60594738-60594760 CAGGGAAAGGAAGGAAGGAAAGG + Intergenic
990886041 5:60594747-60594769 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
991082775 5:62619311-62619333 GATACAAAGGAAGAAAGGAAGGG - Intronic
991348278 5:65693277-65693299 GAGAGAGAGCAAGGAAGGAAGGG + Intronic
991739775 5:69658241-69658263 AATGGAAAGCAAATAATTAATGG + Intergenic
991757724 5:69894936-69894958 AATGGAAAGCAAATAATTAATGG - Intergenic
991791350 5:70237982-70238004 AATGGAAAGCAAATAATTAATGG + Intergenic
991819238 5:70534366-70534388 AATGGAAAGCAAATAATTAATGG + Intergenic
991837127 5:70770818-70770840 AATGGAAAGCAAATAATTAATGG - Intergenic
991883799 5:71238324-71238346 AATGGAAAGCAAATAATTAATGG + Intergenic
992195880 5:74338448-74338470 GAAAGAAAGGAAGAAAGGAAGGG + Intergenic
992221382 5:74577120-74577142 GAAGGAAAGCAAGGAAGGGAGGG + Intergenic
992341452 5:75827968-75827990 GGGTGAAAGCAAATAAGGAAAGG - Intergenic
992456326 5:76919550-76919572 GAGAGAAAGGAAGGAAGGAAGGG - Intronic
992586292 5:78243687-78243709 GATGCAAAGGAAGAGAGGAAGGG + Intronic
992592542 5:78310199-78310221 GAAGGAAAGGAGGAAAGGAAGGG + Intergenic
992705443 5:79386932-79386954 AAAGGAAAGGAAGGAAGGAAGGG - Intronic
992705447 5:79386945-79386967 GAAGGGAAGGAAGAAAGGAAAGG - Intronic
992708760 5:79427625-79427647 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
992708771 5:79427672-79427694 GAAGGAAGGGAAGGAAGGAAGGG - Intronic
992708774 5:79427681-79427703 GAAGGAAAGGAAGGAAGGGAAGG - Intronic
992708775 5:79427685-79427707 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
992708778 5:79427694-79427716 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
992708783 5:79427716-79427738 GAAGGAAGGGAAGGAAGGAAGGG - Intronic
992708786 5:79427725-79427747 GAAGGAAAGGAAGGAAGGGAAGG - Intronic
992708787 5:79427729-79427751 GAAGGAAGGAAAGGAAGGAAGGG - Intronic
992708790 5:79427738-79427760 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
992708795 5:79427760-79427782 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
992824824 5:80538498-80538520 GAAGGAAAGAAAGAAAAGAAAGG - Intronic
993118797 5:83749909-83749931 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
993526588 5:88973246-88973268 GAATGAAAGAAAGAAAGGAAAGG + Intergenic
994048412 5:95335023-95335045 GAGAGAAAGGAAGGAAGGAAAGG - Intergenic
994048419 5:95335170-95335192 AAGGGAAAGAAAGGAAGGAAGGG - Intergenic
994048457 5:95335282-95335304 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
994130314 5:96219684-96219706 GAAGGAAGGGAAGGAAGGAAAGG + Intergenic
994682162 5:102901826-102901848 GATGGATAGAAAGGAAGGGAAGG + Intronic
994881978 5:105509649-105509671 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
994912768 5:105934130-105934152 GAAAGAAAGAAAGAAAGGAAAGG + Intergenic
994952347 5:106480675-106480697 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
995223565 5:109678303-109678325 TATAGATACCAAGTAAGGAATGG - Intergenic
995498079 5:112770031-112770053 AAAAGAAAGCAAGTAAGGAAAGG - Intronic
995767265 5:115632530-115632552 GAAGGAAAGAAAGAAAGGGAAGG + Intronic
995767270 5:115632548-115632570 GAAGGGAAGAAAGGAAGGAAGGG + Intronic
996156304 5:120107039-120107061 GAAGGAAAGGAAGGAAAGAAAGG - Intergenic
996628270 5:125597155-125597177 GAAGTAAAGAAAGAAAGGAAGGG - Intergenic
996668482 5:126088281-126088303 AATGGAAAGCAAAAAAGGCAGGG + Intergenic
997076069 5:130678990-130679012 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
997077796 5:130701225-130701247 GATAGAATGAAAGTAAGGAATGG + Intergenic
998157029 5:139792820-139792842 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
998180756 5:139938968-139938990 GAAGGAAGGGAAGGAAGGAAAGG + Intronic
998180773 5:139939044-139939066 AAGGGAAAGGAAGGAAGGAAGGG + Intronic
998589424 5:143461819-143461841 AAGGGAAAGGAAGGAAGGAAGGG - Intergenic
998589429 5:143461837-143461859 GAGGGAAAGGAAGGAAGGAAGGG - Intergenic
998638911 5:143987460-143987482 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
998671310 5:144357309-144357331 CATGGAAACCAAGTCAGGTAGGG + Intronic
998900168 5:146844721-146844743 GCTGGAAAGAAAGAAAGAAATGG - Intronic
999072772 5:148765189-148765211 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
999072777 5:148765213-148765235 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
999236600 5:150101633-150101655 CAAGGAAAGCAAGCAAGGAGTGG - Intronic
999516210 5:152304112-152304134 GATGGAAAAGAAGTAAGCAGAGG + Intergenic
999681723 5:154066615-154066637 TATAGAAAGGAAGGAAGGAAGGG - Intronic
999780904 5:154849306-154849328 GATGAAATGCATGAAAGGAAAGG + Intronic
999900975 5:156086742-156086764 GGTGGAAGGAAAGTAAGCAAAGG + Intronic
1000018349 5:157298102-157298124 AAAGGAAAGCAGGGAAGGAAGGG - Intronic
1000038352 5:157466057-157466079 GAGAGAAAGGAAGGAAGGAAAGG + Intronic
1000585549 5:163093579-163093601 AAAGGTAAGGAAGTAAGGAATGG - Intergenic
1000684268 5:164227899-164227921 GAAGGAAAACAGGGAAGGAATGG - Intergenic
1000752027 5:165108615-165108637 AATGGAAAGAAAGGAAGGAAGGG - Intergenic
1000790551 5:165601704-165601726 GATGGGATGAAAGAAAGGAAGGG - Intergenic
1000894868 5:166843382-166843404 GAAAGAAAGCAAGAAAGGAAGGG + Intergenic
1000997517 5:167974082-167974104 GAAGGAAGGGAAGGAAGGAAGGG + Intronic
1000997533 5:167974135-167974157 GAAGGAAGGGAAGGAAGGAAGGG + Intronic
1000997569 5:167974236-167974258 GAAGGAAGGGAAGGAAGGAAGGG + Intronic
1000997585 5:167974289-167974311 GAAGGAAGGGAAGGAAGGAAGGG + Intronic
1000997601 5:167974342-167974364 GAAGGAAGGGAAGGAAGGAAGGG + Intronic
1001012984 5:168115326-168115348 GAAGGAAGGGAAGGAAGGAAAGG + Intronic
1001012989 5:168115339-168115361 GAAGGAAAGGAGGGAAGGAAGGG + Intronic
1001396687 5:171423080-171423102 GATGGACAGGAAGAAAGGAGGGG - Intronic
1001448423 5:171805721-171805743 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1001546639 5:172574497-172574519 GAAGAAAAGAAAGAAAGGAAGGG - Intergenic
1001676067 5:173516990-173517012 GAAGGAAAGAAAGAAAGAAAGGG - Intergenic
1001771473 5:174300289-174300311 GATGGAAAGGAGGAGAGGAAAGG - Intergenic
1002261202 5:177995179-177995201 GATGAAAAGTAAGTAGGGGAGGG - Intronic
1002550514 5:179987145-179987167 GAAAGAAAGGAAGGAAGGAAAGG - Intronic
1002556065 5:180041713-180041735 GCCGGGAAGGAAGTAAGGAAAGG + Intronic
1002693561 5:181068761-181068783 GAAAGAAAGGAAATAAGGAAAGG + Intergenic
1002726104 5:181297580-181297602 GAGGGAAGGAAAGGAAGGAAGGG - Intergenic
1003464856 6:6369243-6369265 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1003517391 6:6828169-6828191 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1003878787 6:10462005-10462027 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1003878794 6:10462035-10462057 GAAGGAAAGGTAGGAAGGAAAGG + Intergenic
1003934379 6:10960172-10960194 GAAGGAAGGGAAGAAAGGAATGG + Intronic
1003970711 6:11296641-11296663 AAAGGAAAGGAAGGAAGGAAAGG - Intronic
1004341796 6:14814359-14814381 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
1004583006 6:16972492-16972514 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1004632178 6:17432718-17432740 GAAGAAAAGCAAGCAAGCAAGGG - Intronic
1004798148 6:19113045-19113067 AAAGGAAAGGAAGAAAGGAAGGG - Intergenic
1004798153 6:19113068-19113090 GAAGGAAAGAAAGGAAGGAAGGG - Intergenic
1004874898 6:19941173-19941195 GAAGGAAAGGAAGGAAAGAAAGG + Intergenic
1004874899 6:19941182-19941204 GAAGGAAAGAAAGGAAAGAAAGG + Intergenic
1005235766 6:23760453-23760475 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1005269758 6:24150976-24150998 GAGAGAAAGAAAGGAAGGAAGGG + Intronic
1005285845 6:24326148-24326170 GAAGGAAAGAGAGGAAGGAAAGG + Intronic
1005601817 6:27433882-27433904 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1005608509 6:27500215-27500237 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1005983154 6:30852797-30852819 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1006185889 6:32181523-32181545 GATGGTCAACAAGAAAGGAATGG - Intronic
1006307640 6:33234073-33234095 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
1006452485 6:34113147-34113169 AATGAAAAGAAAGGAAGGAAGGG - Intronic
1006526594 6:34611073-34611095 GAAAGAAAGAAAGAAAGGAAAGG - Intronic
1006573997 6:35030267-35030289 GAAGGAAAGCAACTTACGAAAGG + Intronic
1006745421 6:36338397-36338419 GAAGGAAAGAAAGGAAGAAAGGG + Intergenic
1007103850 6:39269797-39269819 GTTGGAAAGCAACCTAGGAAAGG - Intergenic
1007718450 6:43870639-43870661 GAGGGAAGGAAAGGAAGGAAAGG - Intergenic
1008041658 6:46807742-46807764 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
1008240105 6:49099678-49099700 AATGGAAAGCAAAAAAGGCATGG + Intergenic
1008418676 6:51271953-51271975 GAGGGAAGGAAAGAAAGGAAAGG + Intergenic
1008773359 6:55006860-55006882 AATGGAAAGCAAATAAAGCAGGG - Intergenic
1008828694 6:55731318-55731340 GATGGAAGGCAAGGATGGCAAGG + Intergenic
1009415595 6:63412759-63412781 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1009415604 6:63412806-63412828 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1009435850 6:63617789-63617811 GATGGGAAGCATGAAAGAAAAGG - Intergenic
1009556016 6:65168165-65168187 GATGGAAAGCATGTGAGGCAGGG + Intronic
1009659125 6:66587040-66587062 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
1009863653 6:69368439-69368461 GAGGGACAGAAAGGAAGGAAGGG + Intronic
1009948353 6:70366047-70366069 GATGGGAAGAAAATAAGAAAAGG + Intergenic
1010174790 6:73015807-73015829 CATGGAAAGATAGTAAGGGAAGG - Intronic
1010345960 6:74811186-74811208 GAGGGAAAGAAAGAAAGGAGCGG + Intergenic
1011394704 6:86893754-86893776 AATGGAAAACAAATAAGGCAGGG + Intergenic
1011458997 6:87583636-87583658 AATGAAAAGCAAGTAAGAAAGGG + Intronic
1011484491 6:87828176-87828198 GATGGAAACCAAGTAAAGAGAGG + Intergenic
1012082830 6:94783282-94783304 AATGGAAAGCAAAAAAGGCAGGG - Intergenic
1012443416 6:99283853-99283875 TAGGAAAAGCTAGTAAGGAATGG - Intronic
1012702961 6:102486246-102486268 TATGGAAAGAAAGAGAGGAAAGG + Intergenic
1012806402 6:103898872-103898894 GAAGGAAAGAAAGGAAGGAAAGG + Intergenic
1013677585 6:112482795-112482817 GATGGAAATGAAGCTAGGAATGG + Intergenic
1013702954 6:112796059-112796081 GAAGGAAAGAAAGAAAGAAAGGG - Intergenic
1013766353 6:113578563-113578585 GAAGGAAAGGAAGGGAGGAAGGG - Intergenic
1013887927 6:114993386-114993408 GATGGAAAGAAGTTAAAGAAAGG - Intergenic
1014448831 6:121560035-121560057 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1014448841 6:121560074-121560096 GAAGGAAAGAAAGGAAGAAAGGG - Intergenic
1014468521 6:121785725-121785747 GATGGAAAGCAAGTAGGTGATGG + Intergenic
1014545172 6:122726813-122726835 GGTGGAAAGCAAGGGAGAAAAGG + Intergenic
1014835070 6:126151748-126151770 GAAGGGAAGGAAGGAAGGAAAGG - Intergenic
1015381313 6:132572714-132572736 AATGGAAAGCTAGAAAGAAAAGG + Intergenic
1015416794 6:132958190-132958212 GAAGGAAAGGAAGGAAGAAAAGG + Intergenic
1015576033 6:134672186-134672208 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1015685702 6:135857064-135857086 AATGAAAAGGAAGGAAGGAAGGG - Intronic
1015787640 6:136934203-136934225 ACTGGAAAGAAAGGAAGGAAAGG - Intergenic
1016287534 6:142489846-142489868 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1016540156 6:145155797-145155819 GAGGGGAAACAAGGAAGGAATGG - Intergenic
1017098555 6:150826990-150827012 GAAGGAAAGGAAGGAAAGAAAGG - Intronic
1017225185 6:152013175-152013197 AATGGAAAGGAAACAAGGAATGG - Intronic
1017297208 6:152811923-152811945 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1017297246 6:152812142-152812164 GAAGGAAGGAAAGAAAGGAAAGG - Intergenic
1017341877 6:153333503-153333525 GGAGGGAAGGAAGTAAGGAAAGG + Intergenic
1017394749 6:153984657-153984679 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1017447207 6:154517795-154517817 GACAGAAAGAAAGGAAGGAAGGG + Intergenic
1017755108 6:157522835-157522857 GGAGGAAAGGAAGGAAGGAAGGG - Intronic
1018363087 6:163092346-163092368 GTTGGAAATCAAGTAGGGGAGGG + Intronic
1018631386 6:165825831-165825853 GATGGAAAGAAAGTTGGGAGTGG - Intronic
1018691965 6:166353662-166353684 GATGGAAGGGATGGAAGGAAAGG - Intergenic
1018823809 6:167394385-167394407 GAAGGAAAGAAGGAAAGGAAAGG + Intergenic
1019764717 7:2842094-2842116 GAAGGAAAGGAAGGAAGGGAAGG + Intronic
1019764723 7:2842133-2842155 GAAGGAAAGAAAAGAAGGAAAGG + Intronic
1019989289 7:4681132-4681154 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
1019989318 7:4681227-4681249 GAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1019989322 7:4681245-4681267 AAAGGAAAGGAAGGAAGGAAAGG + Intergenic
1019989338 7:4681296-4681318 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1019989339 7:4681300-4681322 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
1020073514 7:5242745-5242767 GAGAGAAAGAAAGGAAGGAAGGG + Intergenic
1020073518 7:5242783-5242805 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1020073523 7:5242819-5242841 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1020220036 7:6229185-6229207 GAAGAGAAGCAAGTAAGGAGAGG - Intronic
1020226999 7:6288341-6288363 GAGGGAAAGGAAGGAAGGAAAGG - Intergenic
1020571003 7:9861315-9861337 GCTGGCAAGGAAGTAGGGAAAGG + Intergenic
1020825172 7:13017924-13017946 AATAGAAAGCAAGCAAGCAAAGG - Intergenic
1020839444 7:13196956-13196978 GAAAGAAAGAAAGAAAGGAAGGG - Intergenic
1020989970 7:15184417-15184439 GAAGGAAAAGAAGGAAGGAAGGG + Intergenic
1021352942 7:19617598-19617620 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
1021847162 7:24774347-24774369 GATGGACAGGAAGGAAGGAAGGG - Intergenic
1022028496 7:26470046-26470068 GAAGGAAAGAAAGAAAGAAAGGG + Intergenic
1022176904 7:27880248-27880270 GTTGGAAAGCAAAAAAGGGAAGG + Intronic
1022194226 7:28048986-28049008 GAAGGAAGGGAAGGAAGGAAGGG - Intronic
1022211795 7:28218075-28218097 GAAGGTAAGAAAGTAAAGAAGGG + Intergenic
1022278732 7:28883299-28883321 GAGGAAAAGGAAGGAAGGAAAGG - Intergenic
1022393024 7:29959989-29960011 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
1022452623 7:30528962-30528984 AAAGGAAAGAAAGGAAGGAAAGG + Intronic
1022452625 7:30528975-30528997 GAAGGAAAGGAAGGAAAGAAAGG + Intronic
1022541798 7:31144436-31144458 GAGGGAAAGAAAGAAAGGGAGGG - Intergenic
1022725826 7:32980712-32980734 GAAAGAAAGGAAGGAAGGAAGGG - Intronic
1022985837 7:35652617-35652639 GAAGGAAAGAAAGGAAGGAAAGG + Intronic
1023009527 7:35913485-35913507 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1023047072 7:36219511-36219533 GAAGGAAGGAAAGAAAGGAAAGG + Intronic
1023047077 7:36219533-36219555 GAAGGAAAGGAAGGAAGGAGAGG + Intronic
1023062741 7:36343657-36343679 GAAGGAAAGAAAGTAAAGGAAGG + Intronic
1023241186 7:38149218-38149240 GAAGGAAGGAAAGCAAGGAAAGG + Intergenic
1023258320 7:38334298-38334320 GAAAGGAAGGAAGTAAGGAAGGG + Intergenic
1023258329 7:38334342-38334364 GAAAGGAAGGAAGTAAGGAAGGG + Intergenic
1023327556 7:39076253-39076275 GATAGGAAGGAAGGAAGGAAGGG - Intronic
1023397388 7:39763823-39763845 GAAGGAAAGAAAGGAAGGGAAGG - Intergenic
1023733923 7:43218488-43218510 GAAGGGAAGGAAGCAAGGAATGG + Intronic
1023823649 7:43994355-43994377 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
1023867671 7:44245970-44245992 GAAGGAAAGGGAGGAAGGAAGGG + Intronic
1023910056 7:44547395-44547417 AAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1023961424 7:44929937-44929959 GAAGGAAGGAAAGGAAGGAAAGG - Intergenic
1024022629 7:45385816-45385838 GATGTAAAGTATGTAGGGAATGG + Intergenic
1024056511 7:45662956-45662978 GAGTGAAAGCAAGTCAGAAATGG + Intronic
1024070986 7:45785102-45785124 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
1024070989 7:45785111-45785133 GAAGGAAGGGAAGGAAGGAAAGG - Intergenic
1024070991 7:45785120-45785142 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
1024070992 7:45785124-45785146 GAGGGAAGGAAAGGAAGGAAGGG - Intergenic
1024081286 7:45857934-45857956 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1024081287 7:45857938-45857960 GAAGGAAAGGAAGGAAGGGAAGG + Intergenic
1024081290 7:45857947-45857969 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1024258432 7:47556856-47556878 CATGGCATGCAAGGAAGGAATGG + Intronic
1024327867 7:48126225-48126247 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
1024471103 7:49769555-49769577 GAAGGAAAGGAAGGGAGGAAGGG - Intergenic
1024833373 7:53487672-53487694 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1025064129 7:55838543-55838565 GAAAGAAAGAAAGGAAGGAAGGG - Intronic
1025117022 7:56267094-56267116 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1025123200 7:56323762-56323784 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1025135282 7:56406641-56406663 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1025231628 7:57206736-57206758 GAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1025231671 7:57206967-57206989 AAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1025737736 7:64166685-64166707 GAAGGAAAGAAAGGAAAGAAAGG + Intronic
1025898075 7:65722572-65722594 GAAGGAAAGAAAGAAAGAAAAGG - Intergenic
1025932607 7:66008597-66008619 CATGGAAAGCAAGCAATAAATGG - Intergenic
1025948598 7:66124534-66124556 GAAAGAAAGGAAGGAAGGAAGGG - Intronic
1025950788 7:66143825-66143847 CATGGAAAGCAAGCAATAAATGG + Intronic
1025965618 7:66267932-66267954 GAAGGAAGGAAAGGAAGGAAAGG - Intronic
1026104732 7:67411779-67411801 GAAGGAAAGCAAGCAAGCAAGGG + Intergenic
1026324012 7:69293272-69293294 TCTGGAAAGGAAGGAAGGAAGGG - Intergenic
1026492154 7:70872214-70872236 GGTGGAAGGGAAGGAAGGAAGGG + Intergenic
1026589178 7:71680827-71680849 AAAGGAAAGGAAGAAAGGAAGGG - Intronic
1026660088 7:72293062-72293084 GTTAGAAAGAAAGGAAGGAAGGG - Intronic
1026677170 7:72437740-72437762 GAAGGAAAGAAAGGAAGGAAGGG - Intronic
1026681033 7:72466767-72466789 GAAGGAAAGAAGGGAAGGAAGGG + Intergenic
1026684936 7:72501519-72501541 GAAGGAAAGAAGGAAAGGAAAGG + Intergenic
1026951589 7:74350944-74350966 AAGGGAAAGAAAGGAAGGAAGGG + Intronic
1026951595 7:74350966-74350988 GAAGGAAAGGAAGGAAGGGAAGG + Intronic
1027426060 7:78062434-78062456 GCTGGGAAGCAAGTTAGAAAAGG - Intronic
1027739957 7:81989034-81989056 GATGAAAAGTAAGTAAAGATGGG + Intronic
1028180610 7:87718130-87718152 GATGCAAAGCATATAAGTAAAGG + Intronic
1028275694 7:88854516-88854538 GAAGGAAGGAAAGGAAGGAAAGG - Intronic
1028305618 7:89260030-89260052 GAAAGAAAGAAAGGAAGGAAAGG + Intronic
1028900975 7:96100341-96100363 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
1028924714 7:96345507-96345529 GAAAGAAAGGAAGGAAGGAATGG + Intergenic
1029144974 7:98439326-98439348 GAAGGAAAGGAAGGAAGGGAGGG - Intergenic
1029144976 7:98439330-98439352 GAGGGAAGGAAAGGAAGGAAGGG - Intergenic
1029150301 7:98475589-98475611 GGTAGGAAGGAAGTAAGGAAGGG + Intergenic
1029191558 7:98775805-98775827 GAAGGAAAGAAAGGAAGGGAGGG + Intergenic
1029692500 7:102191565-102191587 GAGGGAAAGGAAGGAAAGAATGG - Intronic
1029780904 7:102731250-102731272 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1029870336 7:103684385-103684407 GATAGAAAGCAAGCAAGGACCGG - Intronic
1030237262 7:107278229-107278251 GAAGGAAGGGAAGGAAGGAAGGG - Intronic
1030925016 7:115441056-115441078 GAAGGAAAGGAAGGAAGGAATGG + Intergenic
1031259200 7:119495174-119495196 GATGCAAAGCATATAAGTAAAGG + Intergenic
1031590671 7:123588577-123588599 GACAGAAAGGAAGGAAGGAAGGG - Intronic
1031847371 7:126822438-126822460 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
1032326029 7:130928725-130928747 GAAGGAAAGGAAGGAAGGGAGGG + Intergenic
1032402628 7:131634478-131634500 GAAGGAAAGAAGGAAAGGAAAGG - Intergenic
1032449551 7:132018102-132018124 GAGGGAAAGGAAGGAAGGAAAGG - Intergenic
1032449772 7:132020005-132020027 GAGGGAAAGGAAGGAAAGAAAGG - Intergenic
1032667817 7:134054424-134054446 TATGGGAAGCAAGTAATGAAAGG - Intronic
1033049216 7:137988951-137988973 GAAGGAAAAAAAGGAAGGAAGGG + Intronic
1033124779 7:138698084-138698106 GAGGGAAGGGAAGAAAGGAAGGG + Intronic
1033184963 7:139218990-139219012 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1033271798 7:139938818-139938840 GAAGAAAAGGAAGCAAGGAAAGG + Intronic
1033354869 7:140591645-140591667 GAAAGAAAGAAAGGAAGGAAGGG - Intronic
1033963620 7:146946059-146946081 GAAGGAAGGGAAGGAAGGAAGGG - Intronic
1034030911 7:147762759-147762781 GAAGAAAAGGAAGGAAGGAAGGG + Intronic
1034111517 7:148542220-148542242 AAAGGAAAGAAAGGAAGGAAAGG + Intergenic
1034111522 7:148542233-148542255 GAAGGAAAGGAAGGAAGGGAGGG + Intergenic
1034168263 7:149042616-149042638 GAGAGAAAGAAAGGAAGGAAGGG + Intergenic
1034320514 7:150175836-150175858 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1034419221 7:150980167-150980189 GATGGAGAGAAAGTGAGCAAAGG + Intergenic
1034543256 7:151773119-151773141 GAAGGAAAGGAAGGAAAGAAGGG + Intronic
1034939638 7:155221938-155221960 GACGGAAAGGAAGGAAGGGAGGG + Intergenic
1035175623 7:157048285-157048307 GAAAGAAAGCAAGGAAGGAAGGG - Intergenic
1035537785 8:405859-405881 GAGGGAAAGGAAGAAAAGAACGG + Intergenic
1035724457 8:1815936-1815958 GAAGGAAAGAAAGAAAAGAAAGG + Intergenic
1035776756 8:2194075-2194097 GATGGAAAGCAAGTGGGGGTGGG - Intergenic
1036198572 8:6745979-6746001 GAGGGAAAGAAAAGAAGGAAGGG - Intronic
1036400010 8:8399807-8399829 GAAGGAAAGAAAGAAAAGAAAGG - Intergenic
1036435668 8:8730775-8730797 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1036495744 8:9268547-9268569 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1036505029 8:9347438-9347460 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1036625610 8:10469316-10469338 GAGGGGAAGGAAGAAAGGAAGGG - Intergenic
1036928196 8:12927942-12927964 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1037480676 8:19302331-19302353 GAATGAAAGGAAGGAAGGAAGGG + Intergenic
1037548904 8:19950833-19950855 GAAGGAATGAAAGGAAGGAAGGG + Intronic
1037627329 8:20619500-20619522 GAAGGCAAGCAAGGAAGAAAGGG + Intergenic
1037708980 8:21340637-21340659 GATGGAAAGTTAGCCAGGAATGG - Intergenic
1037711783 8:21360903-21360925 GAGGGAAACCAGGAAAGGAAGGG - Intergenic
1038012486 8:23486123-23486145 AAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1038030517 8:23634546-23634568 GAAGGAAGGGAAGAAAGGAAGGG - Intergenic
1038030520 8:23634559-23634581 GAAGGAAAGAAAGGAAGGAAGGG - Intergenic
1038314635 8:26473603-26473625 GAAGGAAAGAAAGAAAGGGAGGG - Intronic
1038388469 8:27172389-27172411 GACTGAAAGCAAGGAATGAAAGG + Intergenic
1038542266 8:28399889-28399911 GAAGGAAGGAAAGAAAGGAAAGG - Intronic
1038567361 8:28630879-28630901 GAAGGAAGGCATGTCAGGAATGG + Intronic
1038735677 8:30166964-30166986 GAAGGGAAGAAAGGAAGGAAGGG + Intronic
1038900823 8:31841801-31841823 AATGTAAAAAAAGTAAGGAAGGG - Intronic
1039114017 8:34072128-34072150 GAAGGAAAGGAAGAAAGGACCGG - Intergenic
1039126286 8:34205480-34205502 GTTGGTAAGAAAGAAAGGAAAGG + Intergenic
1039562352 8:38522843-38522865 GAGAGAAAGAAAGAAAGGAAAGG - Intronic
1039762166 8:40589726-40589748 GAAAGAAAGAAAGAAAGGAAAGG - Intronic
1039776939 8:40746263-40746285 GAAAGAAAGAAAGGAAGGAAGGG - Intronic
1039963721 8:42269352-42269374 AAAGGAAAGGAAGAAAGGAAAGG + Intergenic
1040699429 8:50043053-50043075 GAGGGAAGGGAAGAAAGGAAGGG - Intronic
1041066962 8:54091563-54091585 GAAGGAAAGAAAGAAAGAAAAGG + Intronic
1041174653 8:55182028-55182050 AATGGATAGCAAGTAAGTCATGG - Intronic
1041178296 8:55220970-55220992 CATGGATTGCAGGTAAGGAAAGG - Intronic
1041239968 8:55841045-55841067 GATGGCCAGCAAGTTAAGAATGG + Intergenic
1041243242 8:55867260-55867282 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
1041311683 8:56523907-56523929 GAAGGAAAGCAGGGAAGGAGTGG - Intergenic
1041497366 8:58501979-58502001 AATGGAAAGGAAGTCAGGCATGG + Intergenic
1041580632 8:59456056-59456078 GAGAGAAAGGAAGGAAGGAAGGG - Intergenic
1042209160 8:66361247-66361269 CATGAAAAGCAAATGAGGAAAGG - Intergenic
1042255486 8:66798998-66799020 AATGGAAACAAAGTATGGAAGGG - Intronic
1042327976 8:67548160-67548182 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1042392512 8:68252125-68252147 GAAGAAAAGGAAGGAAGGAAGGG - Intergenic
1042490221 8:69389299-69389321 CATGGCAAGCAAGGAAGCAAAGG + Intergenic
1042505961 8:69560724-69560746 GAAGGAAAAGAAGTAAAGAAGGG - Intronic
1042630197 8:70807581-70807603 AATGGAAAGCAAAAAAGGCAGGG + Intergenic
1042719250 8:71809234-71809256 GGTGGAAAGAAAGTAGGGATGGG - Intergenic
1042781084 8:72491858-72491880 GATCGAGAGGAAGGAAGGAAGGG + Intergenic
1043084422 8:75810805-75810827 GAAGGAAGGGAAGAAAGGAAGGG - Intergenic
1043707768 8:83374562-83374584 GAAGGAAAAAAAGAAAGGAAAGG + Intergenic
1043726206 8:83614225-83614247 GAAGGAAGGGAAGAAAGGAAAGG - Intergenic
1043862668 8:85338608-85338630 GAAGGAAAGAAAGAAAGAAAAGG - Intronic
1044185519 8:89246032-89246054 GAAGGAAAGAAAGAAAGGGAAGG - Intergenic
1044289918 8:90455650-90455672 GATGGAAAGTGAGAAAAGAATGG - Intergenic
1044453029 8:92360179-92360201 GAAGGAAAGAAAGGAAGGAAGGG + Intergenic
1044547693 8:93477838-93477860 GATGGAAACCAAGGTAGAAATGG - Intergenic
1044642303 8:94396078-94396100 GAAGGAAAAAGAGTAAGGAAGGG + Intronic
1045078964 8:98603783-98603805 GAAGGAAAGGAAGAAGGGAAGGG + Intronic
1045247191 8:100453385-100453407 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1045336988 8:101214336-101214358 GATGGAAAGACAGAAAGGATGGG - Intergenic
1045350263 8:101331701-101331723 GAAGGAAGGAAAGAAAGGAAGGG + Intergenic
1045350265 8:101331705-101331727 GAAGGAAAGAAAGGAAGGGAGGG + Intergenic
1045399703 8:101800998-101801020 GAAAGAAAACAAGGAAGGAAAGG + Intronic
1045519473 8:102891157-102891179 CATGGAAAGCAAGTCATTAATGG - Intronic
1045755319 8:105534363-105534385 GAAGGAAAGAAAGGAAGAAAGGG - Intronic
1045836050 8:106523075-106523097 GGTTGACAGCAAGCAAGGAACGG - Intronic
1046221231 8:111218335-111218357 GAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1046334335 8:112764934-112764956 TATATAAAGCAAGCAAGGAAGGG + Intronic
1046383636 8:113481100-113481122 GGTGTAAACCAAGTAATGAATGG - Intergenic
1046671010 8:117056323-117056345 GATGGAAAGTGAGCAGGGAAAGG - Intronic
1046845479 8:118910544-118910566 GAAGAAAGGCAAGTAAGGAGAGG - Intergenic
1046903447 8:119546623-119546645 GATGGAAAGGAAGGAAAGAGTGG - Intergenic
1047371676 8:124261138-124261160 GAAGGAAAGGAAGGAAAGAAAGG + Intergenic
1047473221 8:125199997-125200019 AATGGAAAGCAAGAAAAGCAGGG - Intronic
1047576858 8:126165956-126165978 GAAGGAAAGGAAGGAAGGGAGGG - Intergenic
1047576860 8:126165960-126165982 GAAGGAAGGAAAGGAAGGAAGGG - Intergenic
1047576879 8:126166033-126166055 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1047794552 8:128241098-128241120 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1048276203 8:133067804-133067826 GAAAGAAAGGAAGGAAGGAAGGG + Intronic
1048366398 8:133742502-133742524 GAAGGAAAGAAAGGAAGGGAGGG + Intergenic
1048958860 8:139559044-139559066 GGTGGAAAGAAAGTCAGCAAAGG - Intergenic
1049304379 8:141892921-141892943 GAGTGAAAACAAGTAAGGCATGG + Intergenic
1049335962 8:142085508-142085530 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1049742116 8:144246080-144246102 GAAGGAAGGAAAGGAAGGAAAGG - Intronic
1049742118 8:144246089-144246111 GAAAGAAAGGAAGGAAGGAAAGG - Intronic
1050194146 9:3062690-3062712 GCTTGAAAGGAAGCAAGGAAAGG - Intergenic
1050315547 9:4397648-4397670 GAAGAAAAGGAAGGAAGGAAGGG + Intergenic
1050499094 9:6276015-6276037 GAAGGAAAACAAGGAAGGGAAGG + Intergenic
1050799575 9:9593104-9593126 GAGAGAAAGGAAGGAAGGAAAGG + Intronic
1051457203 9:17272112-17272134 AAAGGAAAGAAAGGAAGGAAGGG - Intronic
1051563417 9:18469097-18469119 AATGAAAAGAAACTAAGGAAAGG - Intergenic
1051617876 9:19023810-19023832 AAAGGAAAGAAAGGAAGGAAAGG + Intronic
1051802259 9:20948917-20948939 GATGTAATGCAGGTAAAGAAAGG + Exonic
1051813114 9:21073106-21073128 GATGGCAAACAAGACAGGAAAGG - Intergenic
1052137847 9:24937428-24937450 GATGGAAAGAAAGGGAGGGAGGG + Intergenic
1052305692 9:27006702-27006724 GAGGAAAAGGAAGGAAGGAAAGG + Intronic
1052558751 9:30055846-30055868 GAGGGAAAGCGAGAAGGGAAAGG - Intergenic
1052678933 9:31663296-31663318 GAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1052857886 9:33418318-33418340 GATGGAAGGCAAGTCTGGACAGG - Intergenic
1053333152 9:37235452-37235474 GAAGGAAAGGAAGGAAAGAAAGG - Intronic
1053333154 9:37235465-37235487 GAAAGAAAGGAAGGAAGGAAAGG - Intronic
1053356605 9:37451207-37451229 AATGGAAAGCAGGGAAGGTAAGG + Intronic
1054759913 9:68995172-68995194 GAAGGAAAGGAAGGAAGGAAGGG + Intronic
1054780346 9:69160452-69160474 GAAGGAAAGCAAGCAAGGTGTGG - Intronic
1055102774 9:72482284-72482306 GATGGAATCCAGGTTAGGAATGG - Intergenic
1055344069 9:75315438-75315460 TATAGAAAGAAAGGAAGGAAGGG - Intergenic
1055730299 9:79273903-79273925 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1055824515 9:80307181-80307203 GAAGGGAAGGAAGTAAGGGAGGG - Intergenic
1055845892 9:80563386-80563408 AATGGAAAAGAAGGAAGGAAGGG + Intergenic
1056107674 9:83363025-83363047 TATGCAAAACAAGGAAGGAAGGG - Intronic
1056254454 9:84784405-84784427 GATGGAAAGCCAGCAAAGAAAGG - Intronic
1056360659 9:85854638-85854660 AATGAAAAGGAAGGAAGGAAAGG + Intergenic
1056682191 9:88729487-88729509 TGTGGAAAGCAAGGAAGGAATGG + Intergenic
1057006315 9:91563732-91563754 GAAGGGAAGGAAGGAAGGAAGGG + Intronic
1057561699 9:96132991-96133013 GTTGGAAGGCATGGAAGGAAGGG + Intergenic
1057664100 9:97030367-97030389 ATTGCAAAGGAAGTAAGGAAGGG - Exonic
1057667811 9:97059971-97059993 TCTGGAAAGAAAGAAAGGAAGGG + Intergenic
1057784380 9:98075428-98075450 GAAGGAAAGGGAGGAAGGAAAGG + Intronic
1057804320 9:98209741-98209763 GAAGGAAAGGAAGGAAGGAAAGG - Intronic
1057901226 9:98950499-98950521 GAAGGGAAGGAAGGAAGGAAGGG - Intronic
1058211496 9:102174900-102174922 GATGGCAAGGAAGTGAAGAAAGG - Intergenic
1058343491 9:103927336-103927358 GAAGGAAAAGAAGGAAGGAAAGG + Intergenic
1058407977 9:104698889-104698911 GAAGGAAGGAAAGAAAGGAAAGG + Intergenic
1058886270 9:109323499-109323521 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
1058935803 9:109768117-109768139 GAAGGAAAGAAAGAAAGAAATGG + Intronic
1059063756 9:111060549-111060571 GAAGGAAAGAAAGGAGGGAAAGG + Intergenic
1059171674 9:112130584-112130606 GAAGGAAGGAAAGGAAGGAAAGG + Intronic
1059183189 9:112239797-112239819 GAAGAAAAGGAAGGAAGGAAGGG + Intronic
1059204896 9:112455368-112455390 GATGGCAAGGAAGTAAGAACAGG - Intronic
1059551351 9:115232160-115232182 AAAGGAAAGAAGGTAAGGAAAGG - Intronic
1059589028 9:115637612-115637634 GAAGGAAAGAAAGAAAGGAGAGG + Intergenic
1059669677 9:116480152-116480174 GTGGGAAAGGAAGGAAGGAAGGG + Intronic
1059770545 9:117419822-117419844 GAAGGAAAGAAGGAAAGGAAAGG - Intergenic
1059781477 9:117532805-117532827 AATGGAATGCAAGTAATCAAGGG - Intergenic
1059803458 9:117773741-117773763 GAAGGAAAGAAGGAAAGGAAAGG - Intergenic
1059965550 9:119610057-119610079 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1060154529 9:121310009-121310031 GAGAGAAAGGAAGGAAGGAAAGG + Intronic
1060199484 9:121644285-121644307 GAAGGAAAGAAAGAAAAGAAAGG + Intronic
1060255826 9:122030130-122030152 GATGCAAAGCTGGGAAGGAAAGG + Intronic
1060280927 9:122214778-122214800 GATAGGAAGCAAGCAAGTAACGG + Intronic
1060351230 9:122862439-122862461 TATGGATAGCAAGGAAGGAAGGG - Intronic
1060491742 9:124090290-124090312 GAAAGAAAGAAAGGAAGGAAGGG - Intergenic
1061067072 9:128285215-128285237 GAAGGAAGGAAAGAAAGGAAGGG + Intronic
1061224818 9:129275194-129275216 GAAGGAAAGAAAGAAAGGAAAGG - Intergenic
1061312670 9:129774520-129774542 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1061390057 9:130312652-130312674 GAAAGAAAGAAAGAAAGGAAGGG - Intronic
1061514575 9:131081461-131081483 GAGAGAAAGAAAGGAAGGAAGGG - Intronic
1061617368 9:131789189-131789211 GAAGGAAAGAAAGAAAGGGAGGG - Intergenic
1062017972 9:134301226-134301248 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1062201732 9:135306294-135306316 GAAGGAAAGAAAGGAAGGAAGGG - Intergenic
1062330465 9:136040985-136041007 GAAGGAAAGGAAGGAAAGAAAGG + Intronic
1062330468 9:136040998-136041020 GAAAGAAAGGAAGGAAGGAAAGG + Intronic
1062330482 9:136041072-136041094 GAAGGAAAGGAAGGAAGCAAAGG + Intronic
1062330487 9:136041095-136041117 AAAGGAAAGGAAGGAAGGAAAGG + Intronic
1062751238 9:138255226-138255248 GAGGGAAGGAAAGGAAGGAAGGG - Intergenic
1202788510 9_KI270719v1_random:59128-59150 GGTAGAAAGCCAGGAAGGAAAGG + Intergenic
1185447176 X:264888-264910 GATAGAAAGAAAGAAAGAAAAGG + Intergenic
1185476781 X:420187-420209 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1185476785 X:420200-420222 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1185476789 X:420213-420235 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1185476793 X:420226-420248 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1185476797 X:420239-420261 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1185494481 X:544022-544044 GAAGGAAAGAAATGAAGGAAGGG - Intergenic
1185501699 X:601686-601708 GAAGGAAAGAAAGAAAAGAAAGG - Intergenic
1185512703 X:675424-675446 AAAAGAAAGCAAGAAAGGAACGG + Intergenic
1185514087 X:685716-685738 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
1185514101 X:685884-685906 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
1185519886 X:730471-730493 GAAGGAAAGAAAGGAAAGAAAGG - Intergenic
1185519897 X:730628-730650 GAAAGAAAGAAAGGAAGGAAAGG - Intergenic
1185519902 X:730687-730709 GAAGGAAAGAAAGGAAAGAAAGG - Intergenic
1185519911 X:730825-730847 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1185519918 X:730901-730923 GAAGGAAAGAAAGGAAAGAAAGG - Intergenic
1185535119 X:854947-854969 GAAGGAAGGAAAGAAAGGAAGGG - Intergenic
1185535136 X:855077-855099 GAAGGGAAGGAAGGAAGGAAAGG - Intergenic
1185575337 X:1168051-1168073 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1185575356 X:1168196-1168218 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1185674101 X:1834757-1834779 GAAAGAAAGGAAGGAAGGAAGGG + Intergenic
1185676542 X:1853870-1853892 GGAAGAAAGCAAGAAAGGAAGGG + Intergenic
1185803242 X:3032396-3032418 GAAGGAAAGGAAGGAAGGAAAGG + Intronic
1185824860 X:3240477-3240499 AAAGGAAAGAAAGGAAGGAAAGG - Intergenic
1185972619 X:4681946-4681968 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1185972637 X:4682000-4682022 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1186069577 X:5804214-5804236 GAAGGAAAGGAAGAAAGAAAGGG + Intergenic
1186206353 X:7204800-7204822 GATGGAAAGAAAGGAAGGCAGGG - Intergenic
1186309031 X:8297174-8297196 GAAGGAAAGAAAGGAAGGGAGGG - Intergenic
1186389508 X:9144490-9144512 AATGGATAGCAAGTCAGAAATGG - Intronic
1186575924 X:10765911-10765933 GAAAGAAAGAAAGAAAGGAAAGG + Intronic
1186638809 X:11433282-11433304 GAAAGAAAACAAGTGAGGAAGGG + Intronic
1186955856 X:14681339-14681361 GGAAGAAAGCAAGGAAGGAAAGG - Intronic
1186997863 X:15142940-15142962 GAGGGAAACCAAGTGAGAAAGGG - Intergenic
1187247237 X:17563732-17563754 AATGGAAAGCCAGAAAGGAAGGG + Intronic
1187878714 X:23826498-23826520 GATAGAGAGGAAGTATGGAAAGG + Intergenic
1187957687 X:24535939-24535961 GAAGGAAAAGAAGGAAGGAAAGG + Intronic
1188353993 X:29167310-29167332 GAAGGAAAGGAAGAAGGGAAGGG - Intronic
1188559449 X:31451261-31451283 AAAGGAAAGAAAGGAAGGAAAGG - Intronic
1188589547 X:31817030-31817052 GCTAGAAAGCAAGCAAGCAAGGG - Intronic
1188966594 X:36561011-36561033 GAGGGAAAGAAAGAAAGAAAAGG - Intergenic
1189388557 X:40557163-40557185 GAAGGAAAGAAAGAAAAGAAAGG - Intergenic
1189647723 X:43152197-43152219 GTTGGAAAGCGAGTTAAGAAGGG + Intergenic
1189691295 X:43619032-43619054 GACAGAAAGGAAGGAAGGAAGGG - Intergenic
1190029331 X:46956709-46956731 GAAGGAAAGAAAGAAAGGAAAGG - Intronic
1190079809 X:47347421-47347443 GAAAGAAAGAAAGAAAGGAAGGG - Intergenic
1190339321 X:49284393-49284415 AAAGGAAAGAAAGAAAGGAAAGG - Intronic
1190431563 X:50382686-50382708 GATGGAAAACCAGTGAGGGAAGG + Intronic
1190586466 X:51948521-51948543 GAGAGAAAGCAAGAAAGGAGAGG - Intergenic
1190794542 X:53728827-53728849 GAAAGAAAGGAAGGAAGGAAAGG - Intergenic
1190886731 X:54536833-54536855 GAAAGAAAGGAAGGAAGGAAAGG + Intronic
1190894859 X:54606990-54607012 GAAAGAAAGAAAGAAAGGAAAGG - Intergenic
1191136668 X:57070964-57070986 GATGGAAAGCAGATGAGGCAGGG - Intergenic
1191677247 X:63804309-63804331 GAAGGAAAGCAATAAAGGGAAGG + Intergenic
1191826575 X:65372483-65372505 GAAGGGAAGGAAGGAAGGAAAGG + Intronic
1191870982 X:65744779-65744801 GATGGAGAGCATGTGAGAAATGG + Intergenic
1192188455 X:68974785-68974807 GAAAGAAAGAAAGGAAGGAAGGG + Intergenic
1192451633 X:71248532-71248554 GAAGGAAGACAAGTAAGGGAGGG + Intronic
1192541508 X:71977014-71977036 GTTGCAAAGCAAGAAAGGATTGG + Intergenic
1193448362 X:81635216-81635238 CATAGAAAGAAAGTATGGAATGG - Intergenic
1193549638 X:82875300-82875322 GATGGAAAGCAATAAAAGCAAGG + Intergenic
1193559802 X:83004073-83004095 AAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1195002638 X:100656878-100656900 GAAGGAAAGGAAGGAAGGAAGGG - Intronic
1195062698 X:101211836-101211858 GCTGGAAAGCACATAAGGGAGGG - Intergenic
1195261265 X:103133698-103133720 AATGGAAAACAAAAAAGGAAGGG + Intergenic
1195461063 X:105124935-105124957 GAAGGAAAGAAAGAAAAGAAAGG - Intronic
1195694759 X:107658742-107658764 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1195870538 X:109480913-109480935 GAAGGGAAGGAAGGAAGGAAGGG + Intronic
1195961304 X:110389697-110389719 GATAGAAAGGAAGGGAGGAAGGG + Intronic
1196184205 X:112727718-112727740 GAAAGAAAGAAAGAAAGGAAGGG + Intergenic
1196200540 X:112881604-112881626 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
1196200545 X:112881622-112881644 GAAGGAAAGGAAGGAAGGGAAGG - Intergenic
1196202214 X:112898922-112898944 AAAGGAAAGAAAGAAAGGAAAGG + Intergenic
1196203188 X:112909347-112909369 TATGGAAAGCAAGGAAGAAGAGG - Intergenic
1196786513 X:119425830-119425852 GAGGGAAGGCAAGGAAGGCATGG + Intronic
1196855797 X:119982382-119982404 GAAGGAAAGGAAGGAAGAAAGGG - Intergenic
1196913209 X:120505476-120505498 GAAGGAAAGGAAGGAAGGAAGGG - Intergenic
1196913213 X:120505489-120505511 GAAGGAAAGGAAGGAAGGAAAGG - Intergenic
1197202060 X:123756933-123756955 AATGGACAGCAAGTCTGGAATGG + Intergenic
1197536453 X:127694438-127694460 GAAGGAAAGAAAAGAAGGAAAGG - Intergenic
1197816528 X:130504421-130504443 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1197816550 X:130504497-130504519 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1197816565 X:130504548-130504570 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1197816577 X:130504586-130504608 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1197816582 X:130504603-130504625 GAAGGAAGGGAAGGAAGGAAGGG - Intergenic
1197816591 X:130504637-130504659 GAAGGGAAGGAAGGAAGGAAGGG - Intergenic
1198160564 X:134003721-134003743 GAAGGAAGGAAAGGAAGGAAAGG + Intergenic
1198323843 X:135546958-135546980 GAAGGAAAACAAGTAAAGACTGG - Intronic
1198466917 X:136911536-136911558 GAAGGAAGGAAAGAAAGGAAGGG - Intergenic
1198797401 X:140413436-140413458 TATGGAATGCAACTAAAGAAGGG + Intergenic
1199317069 X:146393491-146393513 GAAAGAAAGGAAGGAAGGAATGG - Intergenic
1199452372 X:147991034-147991056 GATGGAAGGTGAGTAAAGAAAGG - Intronic
1199454775 X:148016125-148016147 AATGGAAACCAAGAAAGGGAAGG - Intronic
1199671929 X:150154886-150154908 GCTGGAAAGAAAGTATGGGATGG + Intergenic
1199703511 X:150404046-150404068 GAAGGAAAGGAAGGAAGGAAAGG + Intronic
1199749112 X:150798126-150798148 GGAGGAAAGGAAGGAAGGAAGGG + Intronic
1199813263 X:151371609-151371631 GAAGGAAAGAAAGGAAAGAAAGG + Intergenic
1200132632 X:153859492-153859514 GAAGGGAAGGAAGGAAGGAAGGG + Intergenic
1200409234 Y:2845117-2845139 GAAGGAAGGAAAGTAAGAAAAGG - Intronic
1200486310 Y:3772884-3772906 AATAGAAAGAAAGTAAGTAAAGG - Intergenic
1200685141 Y:6251376-6251398 GAAGGAAAGGAAAAAAGGAAGGG - Intergenic
1200687488 Y:6269475-6269497 GAAGGAAAGCAATGAAGAAAGGG - Intergenic
1200687492 Y:6269505-6269527 GAAGGGAAGGAAGAAAGGAAGGG - Intergenic
1200830549 Y:7685096-7685118 GAAGGAAAGGAAATAAGGAAGGG + Intergenic
1201047782 Y:9905207-9905229 GAAGGGAAGGAAGAAAGGAAGGG + Intergenic
1201047786 Y:9905237-9905259 GAAGGAAAGCAATGAAGAAAGGG + Intergenic
1201146108 Y:11066524-11066546 GAGGGAAAGGAAGGAAGGGAGGG + Intergenic
1201146440 Y:11067566-11067588 GAGGGAGAGAAAGTAAGGGAGGG + Intergenic
1201230845 Y:11862877-11862899 GAAGGAAGGAAAGGAAGGAAGGG + Intergenic
1201505843 Y:14699031-14699053 GAAGGAAAGAAGGAAAGGAAAGG - Intronic
1201550417 Y:15211909-15211931 GAAGGAAAGGAAGGAAGGAAGGG + Intergenic
1201691777 Y:16775014-16775036 GAAGAAAAGGAAGGAAGGAAGGG - Intergenic
1201697427 Y:16841139-16841161 GAGAGAAAGGAAGGAAGGAAGGG + Intergenic
1201733713 Y:17234525-17234547 GAAAGAAAGGAAGGAAGGAAGGG - Intergenic
1201741083 Y:17325338-17325360 GAAGGAAGGGAAGGAAGGAAGGG + Intergenic
1202116452 Y:21472940-21472962 GAAGGAAAGAAACAAAGGAAGGG - Intergenic
1202365988 Y:24165354-24165376 AATGGAAAGCAAGAAAGAAAAGG - Intergenic
1202374427 Y:24220671-24220693 AATGGAAAGCAAGAAAGAAAAGG + Intergenic
1202496353 Y:25449449-25449471 AATGGAAAGCAAGAAAGAAAAGG - Intergenic
1202504794 Y:25504769-25504791 AATGGAAAGCAAGAAAGAAAAGG + Intergenic