ID: 979492009

View in Genome Browser
Species Human (GRCh38)
Location 4:121338914-121338936
Sequence GTGGGGATGGAAAGCAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492009_979492015 5 Left 979492009 4:121338914-121338936 CCTTACTTGCTTTCCATCCCCAC 0: 1
1: 0
2: 1
3: 34
4: 314
Right 979492015 4:121338942-121338964 GTTTTCAGGAGTTCTGATGTTGG 0: 1
1: 0
2: 2
3: 26
4: 254
979492009_979492011 -9 Left 979492009 4:121338914-121338936 CCTTACTTGCTTTCCATCCCCAC 0: 1
1: 0
2: 1
3: 34
4: 314
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492009 Original CRISPR GTGGGGATGGAAAGCAAGTA AGG (reversed) Intronic
900940242 1:5793744-5793766 GTGGGGATTAAAGGCAAGAAAGG + Intergenic
901469522 1:9446591-9446613 GTGGAGATGGCAAGCGAGAAGGG - Intergenic
902513233 1:16977201-16977223 GTGGGGAGGCAAAGCATGTAGGG + Intronic
902652792 1:17847456-17847478 GTGGGGAAGGGAAGCAGGGATGG - Intergenic
902846794 1:19117215-19117237 GTGGAGTTGAAAAACAAGTACGG - Exonic
903127688 1:21258842-21258864 GTGGGGAGGGAGAGCAGGCAGGG + Intronic
903698139 1:25224829-25224851 TTGGGGATGGATAGCAAGTGTGG - Intronic
905096429 1:35475415-35475437 ATTGGAATGGAAAGAAAGTAAGG - Intronic
908082826 1:60598681-60598703 GAGGGGAGGGAAAGGAAGGAAGG + Intergenic
908392783 1:63698733-63698755 GGGTGGATGGGAAGCGAGTAGGG + Intergenic
909197245 1:72643045-72643067 GGGTGGATGGAAAACAAGGATGG + Intergenic
909438308 1:75669662-75669684 GTGGGGATGGGAAGAACGTAAGG - Intergenic
909832724 1:80213216-80213238 GTGGAGATGTAAAGTAATTAGGG - Intergenic
911158245 1:94657000-94657022 GAGGGAATGGAAAGGAAGAAGGG + Intergenic
911175256 1:94811691-94811713 GGGGGGAAGGAAACCAAGCAAGG - Intergenic
911430261 1:97776016-97776038 GTTGGGAGGGAAAGCAGGTGGGG + Intronic
912162497 1:107002793-107002815 GAGGGGATGTAAGGCAAGGAAGG + Intergenic
912309702 1:108607795-108607817 CTGGGAATGGAGAGAAAGTATGG - Intronic
913004819 1:114618681-114618703 ATGGGGAAGGAAAGCAGGAAAGG + Intronic
914413102 1:147450606-147450628 GTAGGGATGGAAAGGAAGCTGGG + Intergenic
914433836 1:147642560-147642582 GGGGTGATGGAAAGCAAGTGAGG + Exonic
915756657 1:158267497-158267519 GTGGGGAAGGGAAGGAAGTGGGG + Intergenic
915912580 1:159923983-159924005 GTGGGGATGGACAGCGTGTGGGG + Intronic
916571364 1:166030741-166030763 GTGAGGCTGGAGAGGAAGTAGGG - Intergenic
918371192 1:183863151-183863173 GTGAGGCTGGAAAGGGAGTAAGG + Intronic
920253833 1:204640630-204640652 TGAGGGATGGAAAGCAAGCATGG - Intronic
920299416 1:204979133-204979155 GTGGGGCTGGAAACCAGGAAAGG - Intronic
921301557 1:213755957-213755979 GAGGGGATGGAAAGCCAGGGAGG - Intergenic
921480047 1:215654046-215654068 TTGGGGAAGAAAAGCAAGTAAGG + Intronic
922879391 1:228969312-228969334 CTGGGGATGGAAAGCAAAGTGGG - Intergenic
922933831 1:229409254-229409276 GTGGGGATGGTGGGCAAGTCTGG - Intergenic
1063631956 10:7742270-7742292 GAGGGGAGGGGAAGCAAGGAAGG + Intronic
1063899054 10:10713013-10713035 GTTGGGATGGACAGGAAGGATGG - Intergenic
1064403517 10:15040573-15040595 GTGGGGAAGGGAAGGAAGGAAGG - Intronic
1064776583 10:18785263-18785285 GTGGGAATGGAAAGAGATTAGGG - Intergenic
1064957497 10:20927022-20927044 GTGGTGGTGGAAAGAAAGGATGG + Intronic
1065169201 10:23010481-23010503 GAGGGGAGGGAAAGGAAGGAGGG - Intronic
1065396677 10:25246628-25246650 GTGGGGATAGGAAGCATATATGG + Intronic
1065413609 10:25459913-25459935 GTTGGGATGGAAATGGAGTAAGG + Intronic
1066444049 10:35465593-35465615 GTGGGTAAGGAAAGCATGCAAGG - Intronic
1066448414 10:35505466-35505488 GTGAGGAAGTAAAGCAACTAGGG + Intronic
1066648835 10:37636868-37636890 GTAGGGAGGGAAAGGAAATAAGG + Intergenic
1066693771 10:38060260-38060282 GTGGGGATGGAAATGAGGTTAGG - Intronic
1067031730 10:42882571-42882593 GTAGGGAGGGAAAGGAAATAAGG + Intergenic
1067524414 10:47029489-47029511 GTGGGGATGGGAAGCCAGGGTGG + Intergenic
1068199614 10:53765998-53766020 TTGGGGATGAAAAGCAATGATGG + Intergenic
1070122415 10:73591379-73591401 GTGGGGAGGGAAGGCTAGGAGGG + Intronic
1070403207 10:76071616-76071638 GAGGGGAGGGAAAGCAAAGAAGG - Intronic
1071394347 10:85206847-85206869 GTGGAGATGGCAGGCAGGTAAGG - Intergenic
1072764900 10:98087384-98087406 GAGAGGAGGGAAAGCAAGTCTGG + Intergenic
1073104037 10:101022114-101022136 GTGGGGATGGTCAGCAAGTGAGG - Intronic
1073191292 10:101652080-101652102 GTGGAGATGGGAAGCAAAGAAGG - Intronic
1074606960 10:114981666-114981688 GTGGGGATGGAAACCAAGTGTGG - Intergenic
1074708388 10:116156533-116156555 GTGGGGATGGATAACATGTTTGG - Intronic
1076036487 10:127202525-127202547 GTGGGGATGGAGGGCAAACAAGG - Intronic
1076568646 10:131416300-131416322 CTGGTGATGGAATGCAAGTGGGG - Intergenic
1076826364 10:132971662-132971684 GTGGGGAAAGAAACCAAGCACGG - Intergenic
1077470785 11:2759610-2759632 GTGGAGATGGAAAGAAAATAAGG - Intronic
1077700189 11:4434207-4434229 GAAGGGAGGGAAAGAAAGTAGGG - Intergenic
1077853263 11:6096213-6096235 GTGGGGAGGCAAAGCCAGTGGGG - Intergenic
1078069245 11:8097409-8097431 GTGAGGATGGGAAGAAGGTAAGG + Exonic
1079366297 11:19813267-19813289 GAGGAGTTGGAAAGCATGTAAGG + Intronic
1079872733 11:25820729-25820751 GAGGGAATGGAAAGCAAAAATGG - Intergenic
1079994585 11:27282178-27282200 GTCTGGATGGAGAGCAAGGAGGG + Intergenic
1080353298 11:31411036-31411058 GTGGGGATTAAAAGAAATTAAGG + Intronic
1080800363 11:35604364-35604386 GTGGAGATGGAAAGGAAGGGAGG - Intergenic
1081250756 11:40830331-40830353 GTTGGCATTTAAAGCAAGTATGG - Intronic
1081844204 11:46227168-46227190 GTGGGGAGGGAAAGACAGTGAGG + Intergenic
1085814452 11:79722041-79722063 GTTGGGATGGAAAGGAAGCTGGG - Intergenic
1085907514 11:80782271-80782293 GTAGTGATGGATAGCAAGTGGGG + Intergenic
1085925602 11:81016380-81016402 GTGGGTATAGAAAGAAAGTATGG + Intergenic
1086592975 11:88537950-88537972 GTGGGGAAGCAATGCAAATAAGG + Intronic
1088951659 11:114577637-114577659 GTGGGGATGGAAAGGTAGTGAGG + Intronic
1089169880 11:116504590-116504612 CTGGGGATGGAAAGCATGAAAGG + Intergenic
1090078433 11:123594185-123594207 GAGGGGATGGGAAGGAAGTCTGG + Intronic
1092286608 12:7132294-7132316 GTGGGGGTGGGAAGCAGGGACGG + Intronic
1092542146 12:9426670-9426692 GGGGAGAAGGAAAGCAAGGAGGG + Intergenic
1092737625 12:11598233-11598255 GTGGGGATGGAAAGAAGGAGAGG + Intergenic
1093145974 12:15567358-15567380 GAGGTGATGGAAAGGAAGGATGG - Intronic
1093478246 12:19578604-19578626 GTAGGAATAGAAAGCAGGTAGGG + Intronic
1094369682 12:29724488-29724510 GTGGTGATGGAAAGAAATTTGGG - Intronic
1094398149 12:30030937-30030959 GAGTGGATGAAAGGCAAGTAGGG + Intergenic
1094510866 12:31095763-31095785 GGGGAGAAGGAAAGCAAGGAGGG - Intronic
1094804943 12:34081196-34081218 TTGGGGATGGAATGCAAGGAGGG - Intergenic
1095116957 12:38366112-38366134 TTGGGGATGGAATGCAAGGACGG - Intergenic
1095998368 12:48108375-48108397 ATGGGGAGGGAAAGGAAGAAGGG + Intronic
1096188455 12:49599309-49599331 GGGGGCCTGGAAAGCAAGTCTGG - Intronic
1096547392 12:52350088-52350110 GTGGGGATGGACAGAAGGGAAGG - Intergenic
1096869695 12:54585554-54585576 GTGGGGAGGGAAGGCAAATGGGG + Intronic
1096968473 12:55647230-55647252 GTGGGGAGGGAAAGTAGGCAAGG + Intergenic
1097057253 12:56257659-56257681 TTGGGGATGGAGAGCAGGTCAGG - Intronic
1097119652 12:56721370-56721392 GTGGGGCAGGAGAGCAAGGAGGG + Exonic
1098034373 12:66287319-66287341 GTGGTCATGGAAAGTAAGGAAGG + Intergenic
1098432045 12:70430387-70430409 ATGGTTATGGAAAGCAAGTTTGG + Intronic
1101056171 12:100916768-100916790 GTGGGCCTTGAAAGCAAGAAGGG + Intronic
1101437645 12:104677809-104677831 GTGGGGCTGGAAGGCAAGCAGGG - Intronic
1101629686 12:106480891-106480913 GGGGGGATGGGAAGCATGTGAGG + Intronic
1101818205 12:108162144-108162166 GTGAGGGTGGAAAGGAAGGACGG + Intronic
1101862460 12:108494169-108494191 GAGGGGCTGGAAAGCAGGCAGGG - Intergenic
1102556693 12:113731460-113731482 GTGAGGATGAAAGGCAAGGAGGG - Intergenic
1103147581 12:118609017-118609039 GTGGGGAGAGAAAGGAGGTAGGG + Intergenic
1103862170 12:124024207-124024229 ATGGGGAAGGAAGCCAAGTATGG - Intronic
1104727827 12:131088574-131088596 GTGGGGACGGAGGGCAAGGAGGG + Intronic
1105595454 13:21833646-21833668 GTGGGGATGGAAAGAATAAAGGG + Intergenic
1106977467 13:35237360-35237382 GCTGGGGTGGAGAGCAAGTATGG - Intronic
1107707630 13:43123082-43123104 GTGGGGATGGAAGCCAAATGGGG + Intergenic
1108094042 13:46881456-46881478 CTGGGGAGGGAAATGAAGTATGG + Intronic
1108569030 13:51731034-51731056 GTGGAATTGGAAAGCTAGTAGGG + Intronic
1110289711 13:73790044-73790066 GTAGGGATGAAAAACAGGTAAGG + Intronic
1111304564 13:86390357-86390379 GTTTGGATGTAAAGGAAGTAAGG + Intergenic
1112128554 13:96496864-96496886 GTGGGGATGGAAAGAAAGCCAGG + Intronic
1112682337 13:101781070-101781092 TTGGGGAGGGAAAGCATGTGGGG - Intronic
1113087068 13:106579871-106579893 GTGGGTATGGAGAGCAAATGAGG - Intergenic
1113518048 13:110918288-110918310 GTGGGGTTGGAGAGCAAGGTAGG + Intergenic
1114615194 14:24064573-24064595 GTGGGGTTGGAGAGCAGGTGTGG + Intronic
1114627600 14:24139501-24139523 GGGGAGGTGAAAAGCAAGTAGGG - Intronic
1114799514 14:25757563-25757585 CTGGGGCTGGAAAGCAGGAAGGG - Intergenic
1115075255 14:29381297-29381319 GTTTGTATGGAAAACAAGTATGG - Intergenic
1118727223 14:68637722-68637744 GTGGGGATGGAAAAGAACCAGGG + Intronic
1118897070 14:69953928-69953950 CTGGGGATAGAAAGCAGGGAGGG - Intronic
1118909904 14:70052824-70052846 GTGTGGAATGAAAGCAATTAAGG - Intronic
1119909238 14:78334751-78334773 GTGGGGATGGGTAGTAATTAGGG + Intronic
1120094476 14:80373351-80373373 GTGGGGATAGAAAAAAAGGAAGG - Intronic
1120981431 14:90292633-90292655 ATGGGAATGGAAAGCAGGCAGGG + Intronic
1121019997 14:90573947-90573969 GTGAGGTTGGAAAGTAAGAAGGG - Intronic
1121538462 14:94707460-94707482 GAGGGAATGGAAAGCATGTCTGG + Intergenic
1121844503 14:97160882-97160904 TTGGGGAAGGAAAGGAGGTAGGG - Intergenic
1124250525 15:28104023-28104045 GTGGGGGTGGGAAGAAAGTGGGG + Intergenic
1126100902 15:45117685-45117707 GTGGGGATCGAAAGAAAGGAGGG - Exonic
1126882092 15:53110257-53110279 GAGGGGATGGGAAGCAGGTGAGG - Intergenic
1127925145 15:63532049-63532071 GTGGGGAAGGCAAGAAGGTATGG - Intronic
1128881990 15:71252443-71252465 GTGAGGATGAAAACCAAGCAGGG - Intronic
1128890243 15:71325485-71325507 GTGGGGATGAAAAGGATGCAAGG + Intronic
1129060093 15:72853863-72853885 GTGGGATTGGAGAGCAAGTGTGG - Intergenic
1129098363 15:73233750-73233772 CTGGGGAGGGAATGCAAGCAGGG - Intronic
1129647391 15:77449127-77449149 GTGGGGGTGGACAGAAAATATGG - Intronic
1130756709 15:86771957-86771979 GTGTGGATAGAAATGAAGTAAGG + Intronic
1130820324 15:87488333-87488355 TTGGGGAAGGAAAACAAGTGTGG + Intergenic
1132833116 16:1939174-1939196 GCGGGGACAGAAAGCAAGCAGGG + Intronic
1133732324 16:8588563-8588585 GTGAGGACTGAAAGCAAGAAAGG - Intronic
1134655154 16:15942560-15942582 GTGGGGAAAGAAAGGAAGTGGGG + Intergenic
1135607175 16:23835359-23835381 GAGGGGATGGACAGAAGGTAGGG + Intergenic
1139958903 16:70706449-70706471 CTGGGGATGGAAATGAAGGAAGG - Intronic
1140158817 16:72462911-72462933 GTGGGGAAGGAATGAGAGTATGG + Intergenic
1142169492 16:88614002-88614024 GTGGGGGTGAAATGCAAGGAGGG + Intronic
1142326727 16:89420574-89420596 CAGGGTATGGAAAGCAAGTTGGG + Intronic
1142503623 17:348759-348781 GTGGGGATGGAACACAGGCATGG - Intronic
1142552758 17:751305-751327 GTGGGGCTGGGAAGCAATTACGG + Intronic
1142782206 17:2190062-2190084 GGGAGGATGGAAAGCAGGAAAGG + Intronic
1143284833 17:5781251-5781273 GTGGGGTTGGAAAGCTAGTGAGG + Intronic
1144335972 17:14269262-14269284 GTGGAGCTGGAAATCAAATAAGG - Intergenic
1144836817 17:18160889-18160911 GAGGAGATGGAGAGCAAGTGAGG - Intronic
1145962181 17:28893257-28893279 GTGGAAAGGGAAAGCAAGTTGGG - Intronic
1147672300 17:42183761-42183783 AAGGGGAAGGAAAGCAAGAAAGG - Intergenic
1147895678 17:43749915-43749937 GTGGGGATGGAGAGGAAGAGAGG - Intergenic
1148896980 17:50844492-50844514 GTGGGGCTGGAGAGCAGGGATGG + Intergenic
1148906609 17:50916380-50916402 GTGGGGATGGAAAGAAACTCTGG + Intergenic
1149386106 17:56144837-56144859 GAGGCGATGGAAAGCAGGAAAGG - Intronic
1149664233 17:58354561-58354583 GGGGTGAGGGAAACCAAGTAGGG + Exonic
1149832928 17:59887555-59887577 ATGGGGATGAAAAGCAGGTAGGG + Intronic
1151310509 17:73289759-73289781 GAGGGGAAGGAAAGGAAGGAAGG + Intronic
1152356312 17:79809371-79809393 GGGGAGAGGGAAAGCAAGTGGGG + Intergenic
1154087086 18:11317292-11317314 GAGGGGAGGGAAAGAGAGTATGG + Intergenic
1157035345 18:43966012-43966034 GTCGGGATGGGAACCAATTATGG - Intergenic
1157887528 18:51383347-51383369 GTGGGGATGGCAGGCTAGGAAGG + Intergenic
1158123898 18:54081465-54081487 ATGGGGATGGAAAGGGAGGAAGG - Intergenic
1159119067 18:64148558-64148580 GTGGGGAAGGAAAGCAAGATGGG + Intergenic
1159939241 18:74393859-74393881 GTGGGGATGGAAGTGGAGTAAGG + Intergenic
1160533586 18:79579173-79579195 GTGCGGATGGAAAGTGAGGATGG - Intergenic
1161213620 19:3081565-3081587 GTTGGGAGGGAGAGCAAGGAGGG + Intergenic
1163805552 19:19394861-19394883 GTGGGGCTGGAGAGCAAGGCGGG + Intronic
1167615368 19:50530097-50530119 GTGGGGATGGAGAGGAAATGGGG - Intronic
925287761 2:2727086-2727108 GTGGAGATGGGAAGCAGGTTGGG - Intergenic
925735272 2:6958344-6958366 GTCGGGGAGGAAAGCAAGGAAGG - Intronic
926015624 2:9448903-9448925 GTGGGTAGGAAAAGCAAGTGGGG - Intronic
927088172 2:19690521-19690543 GAGGGGAGGGAAAGGAAGGAGGG + Intergenic
927421141 2:22931933-22931955 GTGGGCATGAAAATCAAGCATGG + Intergenic
927559668 2:24061071-24061093 GTGGGGACGCAAAGCCAGGAGGG - Intronic
928955274 2:36860109-36860131 GAGGGGATGGAAAGGGAGCAAGG + Intronic
929266685 2:39926114-39926136 TTGGGGATGGAAATCTGGTAAGG + Intergenic
930002474 2:46870509-46870531 GTGGGGCTGGGAAGCAGGCAGGG - Intergenic
930901811 2:56516237-56516259 GTGTGGAAAGAAAGCAAGAATGG + Intergenic
931121311 2:59223288-59223310 GTGGGGATGGGAAGCAACAGGGG + Intergenic
931130895 2:59334289-59334311 GTGGGGGTGGAGAGGAAGAAGGG - Intergenic
932306204 2:70705683-70705705 GTGGGAAGGGAAGGCAAGTCGGG - Intronic
933538752 2:83611444-83611466 GTGGGCAGGGAAAGGAAGAAGGG + Intergenic
933549189 2:83753215-83753237 GTGGGGATGGTAAGGAAGAGTGG - Intergenic
935550782 2:104451260-104451282 GTAGGGAGGGAAAGGAAGTCAGG + Intergenic
936417405 2:112329340-112329362 ATGGGAATGAAAAGAAAGTAAGG + Intronic
936447429 2:112607160-112607182 GAGGGGAGGGAAAGAAAGGAGGG - Intergenic
937239709 2:120452217-120452239 GTGGGGATGGAGTGAAAGTGGGG - Intergenic
939209965 2:139161911-139161933 TTGGGGATAGAAAGAAAGTCAGG - Intergenic
939701921 2:145402613-145402635 CTGGGGATGGAAAGAAATTTAGG - Intergenic
941228914 2:162884415-162884437 GTGGGGATGAGAAGAAAGGATGG + Intergenic
941765469 2:169291881-169291903 CTGGGGAAGGAAAGAAAATAGGG - Intronic
942455267 2:176133816-176133838 GTGGGTACGGAAATCAAGGAAGG + Intergenic
943400167 2:187398754-187398776 CTGGGGTTGCAAAGCAAGTAGGG + Intronic
944921486 2:204418399-204418421 ATGGGGATGGAAGGGTAGTAGGG + Intergenic
945576200 2:211532150-211532172 GTGGGGGGGGAAAGTAGGTATGG + Intronic
946505775 2:220299163-220299185 GTGGGAATGTAAAGAAGGTAAGG + Intergenic
947403820 2:229754309-229754331 GTGGGGATGGAAGGGCAGTGTGG + Intergenic
947429577 2:230014350-230014372 GTGGGGAGGGACTGCAAGCAGGG + Intergenic
948321660 2:237074524-237074546 GAGTGGATGGAAAACAAGGAAGG + Intergenic
1170289369 20:14751186-14751208 GTGGGGCTGGGAGGCCAGTAAGG - Intronic
1170372434 20:15664230-15664252 GGGGGGATGGAAAGCAAAGGAGG + Intronic
1170428384 20:16257606-16257628 TTGGGGATGGAAAGAAAGGGTGG - Intergenic
1172588706 20:36102781-36102803 GTGGGGACGGAAAGGGAGAAAGG - Intronic
1173732389 20:45337874-45337896 GTGGGGGTGGAAAGCCAGAGAGG + Intronic
1173928920 20:46802076-46802098 ATGGGAAAGGAAAGAAAGTAGGG - Intergenic
1173982852 20:47238259-47238281 GTGGGGGAAAAAAGCAAGTATGG + Intronic
1174475913 20:50795386-50795408 GTGGGGAGGGAAAGCGAGCCTGG - Intronic
1175125584 20:56749088-56749110 GGGGGGATGAAAAGAAAGGAGGG - Intergenic
1177479398 21:21667478-21667500 GTGGGGATGGTAAGGGAGAAAGG + Intergenic
1178978992 21:37245163-37245185 GTGGGAAGGGAAAGGAAGGAGGG + Intronic
1181148346 22:20864798-20864820 CTGGGGAAGGAAAGGAAGGAGGG + Intronic
1181299629 22:21870319-21870341 ATGGGGATGGACAGCATCTAGGG + Intergenic
1181581291 22:23829456-23829478 GTGGGGATGAAAAGAGACTAAGG + Intronic
1181625920 22:24121998-24122020 GTGGGGAAGGACAGCAGGTTTGG + Intronic
1181670688 22:24424292-24424314 GCGGGGAGGGAAGGCAAGTGCGG + Intronic
1181953611 22:26572278-26572300 GCGGGGAGGCTAAGCAAGTAGGG + Intronic
1182740405 22:32563369-32563391 GTGTGGATGCAAAGCAGGGAGGG + Intronic
1182985728 22:34714357-34714379 GTGGGAGAGGAAAGCAAGTGAGG - Intergenic
1183766102 22:39876560-39876582 GAGAGGAGGGAAAGCAAGCAGGG + Intronic
1184459008 22:44626667-44626689 GTGGGGAAGGGAAGAAAGTTGGG - Intergenic
1185183446 22:49377926-49377948 GTAGGAATGGAAAGAGAGTAAGG + Intergenic
1185288192 22:50011585-50011607 GTGGAGATGGAAAACAGGGAGGG - Intronic
949118402 3:356649-356671 GTGGAGATGGGAAGGAAGTGAGG + Intronic
950309005 3:11939627-11939649 GTGAGGAAGGAAGGCAAGTGAGG + Intergenic
950614551 3:14148480-14148502 ATGGGGATGGAAAGCTGGCATGG - Intronic
951499878 3:23373245-23373267 GTGGAAATGGAAAGGAAGGACGG + Intronic
953454666 3:43032179-43032201 ATGGGGATGGTAAGCAAATGAGG - Intronic
953755956 3:45646122-45646144 GTGTGGCTGGAAGGCAAGCAAGG - Intronic
955238865 3:57163082-57163104 GTGGGAATGCAAAGCATGTGGGG + Intronic
957615974 3:82528022-82528044 GTGGTGCTGTAAAGGAAGTAAGG - Intergenic
957832297 3:85538296-85538318 GTGGGGATCAAAAGGAACTATGG - Intronic
959619588 3:108385769-108385791 GGGGGAATGGAAGGTAAGTAGGG - Intronic
960059906 3:113310311-113310333 GTGGGGATGGCAAGTACTTATGG - Intronic
961616670 3:128188159-128188181 GGAGGGATGGAAAGGAAGGAAGG + Intronic
961987755 3:131155848-131155870 GTGAGGATGGAAAGCAAACATGG - Intronic
963459210 3:145586582-145586604 TTGGGGATGGAAAGCAAAGTGGG + Intergenic
965631259 3:170735099-170735121 CTGAGAATGGAAAGCATGTATGG + Intronic
966673929 3:182564489-182564511 GTGGGGATGGGGAGCAATTTTGG - Intergenic
967691591 3:192480117-192480139 GTGGGGATGGAGACAAAGAAAGG + Intronic
968025846 3:195442387-195442409 GAGGGGGTGGAAACCAAGAAGGG + Intronic
970068990 4:12133897-12133919 GTGTGGCTGGAATGCAAGGATGG + Intergenic
971530245 4:27678807-27678829 GTGGGGATGGACAGGAAAAATGG - Intergenic
972396817 4:38664642-38664664 GTGGGGGCGGAGAGCAAGCAAGG + Intronic
973079369 4:45970806-45970828 GTGGGGATGGAATACCAGAAAGG + Intergenic
974017953 4:56666162-56666184 GTGGGGAAGGAAAGCCAGCCTGG - Intronic
975878319 4:78869954-78869976 GTGGGGAGAGAATGCAAGGAGGG - Intronic
977423013 4:96827730-96827752 CTGTGGATGGAATGCAATTATGG - Intergenic
978879969 4:113689835-113689857 GTGGGAATGGAAAACTGGTAGGG - Intronic
979492009 4:121338914-121338936 GTGGGGATGGAAAGCAAGTAAGG - Intronic
979722029 4:123911550-123911572 GTGGAGATGGAAAATAACTAGGG + Intergenic
979896394 4:126163261-126163283 GTGGGGAAGGAAAGAAAGACAGG + Intergenic
980851818 4:138392114-138392136 GTAGGGAAGGAAAGAAAATAGGG - Intergenic
981001027 4:139829178-139829200 GTGGGAAAGGAAAGAAAGGAAGG + Intronic
981953090 4:150434900-150434922 GTGTGAATGTAAAGCATGTAAGG - Intronic
985354465 4:189102916-189102938 ATGTGGATGGAAATGAAGTATGG + Intergenic
985657677 5:1140509-1140531 GTGGGGAGGGGAAGCCAGCAGGG - Intergenic
986033142 5:3911750-3911772 GTGGGGATGAACAGCCAGGAGGG - Intergenic
986417879 5:7546619-7546641 GTGAGGGAAGAAAGCAAGTATGG - Intronic
988801328 5:34698912-34698934 GTGGGGATGAAGAGCAAGCAGGG + Intronic
988989002 5:36651205-36651227 GTGGGGAAGGAACCCAAGGAGGG - Intronic
989422574 5:41256880-41256902 TTGGGGATGGAAAGTGGGTATGG - Intronic
990658741 5:57988203-57988225 GTGAGGAAGGAAAGGAAGGAGGG - Intergenic
990893808 5:60675707-60675729 GTGGGGCTGAAAAGGAAGGAAGG - Intronic
992997865 5:82350045-82350067 GTGAGGATGGGAAGTATGTACGG - Intronic
993551739 5:89281682-89281704 GTGTGGTTGGAATGCAAGCATGG + Intergenic
994575120 5:101567920-101567942 GTGGGGTCGGGAAGGAAGTATGG - Intergenic
995017410 5:107326527-107326549 GTGAAGAAGGAAAGCCAGTAAGG + Intergenic
995933676 5:117483079-117483101 GGGGAGATGGAAAGAGAGTATGG + Intergenic
998671308 5:144357304-144357326 GAGGGCATGGAAACCAAGTCAGG + Intronic
998906229 5:146908280-146908302 GTTGTGATGAAAACCAAGTATGG + Intronic
999287207 5:150401265-150401287 GTCAGGATGGACAGGAAGTAGGG - Intergenic
999791610 5:154945130-154945152 GTGGGGATGGGGAGCAAGGATGG + Intronic
1000009290 5:157216624-157216646 GTGGGGAGGGAAAGGAAGGAAGG + Intronic
1000595561 5:163211540-163211562 ATGGGCATGTAAAGCAAATAGGG - Intergenic
1000738738 5:164938191-164938213 GTAGGGAAGGAACTCAAGTAGGG + Intergenic
1001307094 5:170583215-170583237 GTGGGGAGAGAAAGAAAGTCTGG - Intronic
1002016326 5:176326173-176326195 ATGGGGATGGGAAGCACGCATGG - Intronic
1002261205 5:177995184-177995206 GAGGAGATGAAAAGTAAGTAGGG - Intronic
1002715635 5:181224848-181224870 GGGGGGATGGAGAGGAAGTAAGG + Intronic
1003574553 6:7280516-7280538 TTGGGAATGGAAAGTCAGTATGG + Intronic
1005320285 6:24646410-24646432 TTGGTGAAGGAAAGCAGGTAGGG - Intergenic
1005913807 6:30334177-30334199 GTGGGGATGCAAAGCCAGGATGG - Intronic
1006877930 6:37314763-37314785 GTGGGGGTGGGCAGCAGGTAAGG - Intronic
1007098990 6:39231600-39231622 GCTGGGATGGAAACCAAGCATGG + Intergenic
1011055448 6:83199114-83199136 GAGGGGATGGATGGCATGTAAGG - Intergenic
1011218521 6:85030637-85030659 CAGGGGTTGGAAAGAAAGTAAGG - Intergenic
1011323684 6:86125612-86125634 GGGGGGAAGAAAGGCAAGTATGG - Intergenic
1013373133 6:109487652-109487674 GTTGGGTTGGATAACAAGTATGG + Intergenic
1015206262 6:130643047-130643069 GTAGGGATGGTAATCATGTATGG - Intergenic
1015445364 6:133297676-133297698 GTGGGGATGGCAGGAAAGTAAGG - Intronic
1015787641 6:136934208-136934230 GTGGGACTGGAAAGAAAGGAAGG - Intergenic
1017935178 6:158999383-158999405 CTGGGGATGGGGTGCAAGTATGG + Intronic
1021932954 7:25599684-25599706 GTGGGGAATGAAAGAAAGTGAGG + Intergenic
1022343222 7:29487704-29487726 GTAGGGAGGGAAAGGAAGGAGGG - Intronic
1022531514 7:31069821-31069843 GTGGGGAGTGAAAGCAAGCTTGG + Intronic
1022954785 7:35371005-35371027 AGGGGGATGGGAAGCAAGGATGG + Intergenic
1023484904 7:40675806-40675828 ATGGGGCTGGAAAGCAAGGAAGG + Intronic
1026185791 7:68081882-68081904 GTGGGGGAGGAAGGCAAGTGTGG + Intergenic
1029673973 7:102053568-102053590 GTGGGGCTGGAAAGGTGGTATGG - Intronic
1031306737 7:120137378-120137400 GTGGGGGTGGGAAGAAAGTAAGG + Intergenic
1032553304 7:132805776-132805798 GGAGGCATGGAAAGCAAGGATGG + Intronic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1034067160 7:148148053-148148075 GTGTGGAAGGAAAGGAAGGAAGG + Intronic
1034563917 7:151898704-151898726 GTGGGAGAGGAAAGCATGTAGGG - Intergenic
1035730482 8:1850464-1850486 GTGGGCATGGACGGCAAGTGCGG + Intronic
1035776759 8:2194080-2194102 CTGCTGATGGAAAGCAAGTGGGG - Intergenic
1036773470 8:11594173-11594195 GTGGGAATGGAAAGGAAGAGAGG - Intergenic
1041279248 8:56194970-56194992 GAGGGGTTAGAAAGCAAATAAGG + Intronic
1041299794 8:56398899-56398921 GAGGAGATAGAAAGCAAATATGG - Intergenic
1041902790 8:63000452-63000474 GTGGGGAGGGAAAGTGAGAAAGG + Intergenic
1042719252 8:71809239-71809261 CTGGCGGTGGAAAGAAAGTAGGG - Intergenic
1044640749 8:94378904-94378926 GTGAGTATGGACAGCAAGAATGG + Intronic
1045409790 8:101905341-101905363 GAAGGGAAGAAAAGCAAGTAGGG - Intronic
1045986159 8:108251779-108251801 GTGGGGGTGGGAGGGAAGTAAGG + Intronic
1046023864 8:108699087-108699109 GAGGGGAGGGAAAGCAATGATGG - Intronic
1046671011 8:117056328-117056350 GTGGTGATGGAAAGTGAGCAGGG - Intronic
1047591781 8:126334893-126334915 GTGGGGGTGGCTATCAAGTAGGG + Intergenic
1049763215 8:144340152-144340174 GTGGGGAGGGACAGCATGGAAGG + Intergenic
1051436346 9:17037012-17037034 GTGGTGATTGAAAGCAGATATGG - Intergenic
1052721376 9:32175065-32175087 GTGGTGAGGGAAAGGAAGGAAGG - Intergenic
1054780347 9:69160457-69160479 GTAGTGAAGGAAAGCAAGCAAGG - Intronic
1055525134 9:77125679-77125701 GTAGGGATGATAAGCAAGTTAGG + Intergenic
1055595075 9:77857617-77857639 GTGGGGAAGAAAAGGAAGGACGG + Intronic
1055792285 9:79935695-79935717 GAGGGGAGGGAAAGAAAGAAAGG - Intergenic
1059224937 9:112663222-112663244 GGGGGGATAGACAGAAAGTAGGG - Exonic
1185535076 X:854770-854792 GTAGGGAGGGAAAGAAAGTAGGG - Intergenic
1185766868 X:2732730-2732752 GGAGGGATGGAAAGAAAGGAAGG - Intronic
1186206355 X:7204805-7204827 GAAGGGATGGAAAGAAAGGAAGG - Intergenic
1188032964 X:25284857-25284879 GTGGGGAAGGCAAGAAAGTTGGG + Intergenic
1189876146 X:45438273-45438295 GTGGACATTGAAAGTAAGTAAGG + Intergenic
1190443266 X:50496977-50496999 GTGGGGATGGTAAGCAGGAAGGG - Intergenic
1190845443 X:54186555-54186577 GTAGGGAAGGAAAGCAAGCAGGG + Intergenic
1191031852 X:55982101-55982123 CTGAGGAAGGAAAGCAAGCAGGG + Intergenic
1192180879 X:68914811-68914833 GTGAGGATAGGAAGCAATTACGG + Intergenic
1192576901 X:72250152-72250174 GTGGGGATAGAAGGCGAGTGAGG + Intronic
1193658811 X:84231658-84231680 GTGGGGAAGGATAGGAAGGAAGG + Intergenic
1195062701 X:101211841-101211863 CTGGGGCTGGAAAGCACATAAGG - Intergenic
1195398321 X:104435083-104435105 GAGGAGATGGAAAGGAAGGAGGG - Intergenic
1195498156 X:105562040-105562062 ATGGGAATGGGAAGCAAGAAGGG - Intronic
1196288075 X:113905728-113905750 GAGAGGAAGGAAAGAAAGTAGGG - Intergenic
1197469142 X:126846351-126846373 GAGGGGGTGGAAAGCAAGAAGGG + Intergenic
1198820628 X:140644510-140644532 GTGGGGGTGGAAAGCGTGTTAGG + Intergenic
1199099629 X:143783706-143783728 TTGGGGATGGAGTGGAAGTATGG - Intergenic
1199563310 X:149187294-149187316 GTGGGAATGGAAAAGAAGGATGG - Intergenic
1199775511 X:151007822-151007844 GTGAGGATGTAGAGCAAGTGGGG + Intergenic
1200219076 X:154381865-154381887 ATGGGGATGGAAAGAAAATGAGG + Intergenic