ID: 979492011

View in Genome Browser
Species Human (GRCh38)
Location 4:121338928-121338950
Sequence CATCCCCACATGCTGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979492002_979492011 27 Left 979492002 4:121338878-121338900 CCTTTTAAATAACTCCCCTCCTC 0: 1
1: 1
2: 1
3: 29
4: 234
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492003_979492011 13 Left 979492003 4:121338892-121338914 CCCCTCCTCCATGTAATCCTTTC 0: 1
1: 0
2: 1
3: 25
4: 307
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492004_979492011 12 Left 979492004 4:121338893-121338915 CCCTCCTCCATGTAATCCTTTCC 0: 1
1: 0
2: 3
3: 30
4: 374
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492006_979492011 8 Left 979492006 4:121338897-121338919 CCTCCATGTAATCCTTTCCTTAC 0: 1
1: 0
2: 1
3: 18
4: 253
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492005_979492011 11 Left 979492005 4:121338894-121338916 CCTCCTCCATGTAATCCTTTCCT 0: 1
1: 0
2: 2
3: 32
4: 355
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492008_979492011 -4 Left 979492008 4:121338909-121338931 CCTTTCCTTACTTGCTTTCCATC 0: 1
1: 0
2: 1
3: 203
4: 1661
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492009_979492011 -9 Left 979492009 4:121338914-121338936 CCTTACTTGCTTTCCATCCCCAC 0: 1
1: 0
2: 1
3: 34
4: 314
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data
979492007_979492011 5 Left 979492007 4:121338900-121338922 CCATGTAATCCTTTCCTTACTTG 0: 1
1: 0
2: 3
3: 23
4: 298
Right 979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979492011 Original CRISPR CATCCCCACATGCTGTTTTC AGG Intronic
No off target data available for this crispr