ID: 979495413

View in Genome Browser
Species Human (GRCh38)
Location 4:121377711-121377733
Sequence AATCCTGTTTTTGCTCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979495410_979495413 24 Left 979495410 4:121377664-121377686 CCTGACTCTTCTGTGCTCGTAGA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 979495413 4:121377711-121377733 AATCCTGTTTTTGCTCATTTTGG No data
979495412_979495413 -10 Left 979495412 4:121377698-121377720 CCTTTTTCTATCAAATCCTGTTT 0: 1
1: 0
2: 5
3: 42
4: 1058
Right 979495413 4:121377711-121377733 AATCCTGTTTTTGCTCATTTTGG No data
979495409_979495413 28 Left 979495409 4:121377660-121377682 CCTTCCTGACTCTTCTGTGCTCG 0: 1
1: 0
2: 1
3: 25
4: 222
Right 979495413 4:121377711-121377733 AATCCTGTTTTTGCTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979495413 Original CRISPR AATCCTGTTTTTGCTCATTT TGG Intronic
No off target data available for this crispr