ID: 979495646

View in Genome Browser
Species Human (GRCh38)
Location 4:121380012-121380034
Sequence TGTGGCTTAGAGACATAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979495646_979495654 -3 Left 979495646 4:121380012-121380034 CCAACCTATGTCTCTAAGCCACA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 979495654 4:121380032-121380054 ACAAGGAGGAAGCACTGGAGGGG No data
979495646_979495652 -5 Left 979495646 4:121380012-121380034 CCAACCTATGTCTCTAAGCCACA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 979495652 4:121380030-121380052 CCACAAGGAGGAAGCACTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 251
979495646_979495657 30 Left 979495646 4:121380012-121380034 CCAACCTATGTCTCTAAGCCACA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 979495657 4:121380065-121380087 GGCCAAAAGAACTTATGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
979495646_979495650 -8 Left 979495646 4:121380012-121380034 CCAACCTATGTCTCTAAGCCACA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 979495650 4:121380027-121380049 AAGCCACAAGGAGGAAGCACTGG 0: 1
1: 0
2: 4
3: 27
4: 265
979495646_979495656 9 Left 979495646 4:121380012-121380034 CCAACCTATGTCTCTAAGCCACA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 979495656 4:121380044-121380066 CACTGGAGGGGAATCAGAGGCGG 0: 1
1: 0
2: 5
3: 30
4: 280
979495646_979495653 -4 Left 979495646 4:121380012-121380034 CCAACCTATGTCTCTAAGCCACA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 979495653 4:121380031-121380053 CACAAGGAGGAAGCACTGGAGGG 0: 1
1: 0
2: 1
3: 37
4: 299
979495646_979495655 6 Left 979495646 4:121380012-121380034 CCAACCTATGTCTCTAAGCCACA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 979495655 4:121380041-121380063 AAGCACTGGAGGGGAATCAGAGG 0: 1
1: 0
2: 0
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979495646 Original CRISPR TGTGGCTTAGAGACATAGGT TGG (reversed) Intronic
901594884 1:10377073-10377095 GGTGGCTTAGAGACTAAGGGAGG + Exonic
904472810 1:30746360-30746382 TGTTGGTTAGGGACATGGGTGGG - Intronic
904855649 1:33496467-33496489 TATGGGTGAGAGATATAGGTGGG + Exonic
906795988 1:48696772-48696794 TGTGGCCTACAGAGATAGCTTGG + Intronic
907583375 1:55592152-55592174 TCTGACTTAGAGGCACAGGTTGG + Intergenic
907700154 1:56778254-56778276 TGTGGTGTACAGAAATAGGTGGG - Intronic
909970446 1:81979070-81979092 TTTGACTGAGAGACAAAGGTTGG - Intronic
910330447 1:86067170-86067192 TCAGGCTTGGAGACATAGGAAGG + Intronic
912490587 1:110060648-110060670 TGGGGCTTGGAGGCAGAGGTGGG + Exonic
913126460 1:115794907-115794929 TGTGCCATGGAGACATAGGAAGG - Intergenic
913530619 1:119731938-119731960 GGTGCCTTAGGGACACAGGTGGG + Intronic
917156062 1:172000289-172000311 TGTGGCTGAGAGATAGAGGAGGG + Intronic
917668143 1:177245796-177245818 TGGGGCTTGGGGACATAGGGAGG - Intronic
920453381 1:206078062-206078084 TGTACCTTATAGACATAGGCTGG - Intronic
922067051 1:222154515-222154537 TGTGCATTAGAGACATATGCTGG - Intergenic
924434908 1:244030688-244030710 TGTGGCTTAGAGAAGGAGGAGGG - Intergenic
1064293349 10:14055045-14055067 AGTGGCTTTGAGATACAGGTGGG - Intronic
1064556572 10:16552523-16552545 TGTGGATTAGCGCCCTAGGTGGG + Intergenic
1065620950 10:27580328-27580350 TGTTGCTTAGTGACAAAGGAGGG + Intergenic
1065940743 10:30562187-30562209 TGTGACTTACAGACCAAGGTGGG + Intergenic
1066635827 10:37498624-37498646 TGGGGATTAGAGGCATAGCTAGG - Intergenic
1067950616 10:50734311-50734333 CTTGGATTATAGACATAGGTTGG + Intergenic
1069744763 10:70708217-70708239 TGTGGGTTAGAGATAAAGGGTGG + Intronic
1073234593 10:102003081-102003103 TGTGGCTCAGAGAACTGGGTGGG - Intronic
1073911921 10:108355951-108355973 TGTGGGTTAGAGACCTCGATGGG - Intergenic
1074235666 10:111582183-111582205 TGTGGCTTGGAGACCTTGGCAGG - Intergenic
1074598705 10:114891321-114891343 GGGGGCATAGAGACATAGATGGG + Intronic
1075461970 10:122622545-122622567 TGTGGCTGAGAGACAGCAGTGGG + Intronic
1079826210 11:25198230-25198252 TGTGGTTTAGAGAGATATGGAGG + Intergenic
1080036268 11:27714997-27715019 TGTGGCCTAGAGACAAAGACTGG - Intronic
1080250909 11:30232461-30232483 TGTGACTTGGAGACATATTTTGG - Intronic
1080284418 11:30592055-30592077 GATGGCTTAGAGACATAGGGAGG - Intergenic
1080322974 11:31036446-31036468 TCTGTCACAGAGACATAGGTGGG - Intronic
1080745879 11:35108359-35108381 TCTGACCAAGAGACATAGGTGGG - Intergenic
1081252819 11:40857020-40857042 TGAGGCCTAAAGACATAGGTTGG + Intronic
1082743266 11:56934897-56934919 TTTGGCATAGAGACATAGAGTGG + Intergenic
1084304304 11:68271779-68271801 TGGGACTGAGAGACAGAGGTTGG - Intronic
1087170556 11:95045568-95045590 TGTGGGTTAGAGCCAAAGATAGG - Intergenic
1088932097 11:114362732-114362754 AGGGGCTTAAAGTCATAGGTGGG - Intergenic
1089325517 11:117654171-117654193 GGTTGCTTAGGGACAGAGGTGGG + Intronic
1091358159 11:134954132-134954154 TGTGGCTTAGAGTCAGATGGTGG - Intergenic
1091746747 12:2997619-2997641 TGTGCTTTAGAGACAGAGGTGGG + Intronic
1093857857 12:24127510-24127532 GGTGGCTTAGAGATAAATGTAGG - Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1099947139 12:89257633-89257655 TGCAGCTTAGAGCTATAGGTTGG - Intergenic
1101735983 12:107463611-107463633 TGTGGCTTAGGGACAAACTTTGG - Intronic
1105895222 13:24711532-24711554 TGCTGCTGAGAGACATAGGAAGG - Exonic
1109228682 13:59728520-59728542 TGTGTATAAGGGACATAGGTAGG + Intronic
1111359282 13:87153593-87153615 TGTGTCTTAGGGACATATGAAGG - Intergenic
1112339140 13:98538077-98538099 TGTGGATTAGTGACATTGATGGG - Intronic
1113074189 13:106451900-106451922 TGAGGGTTAGAGACAGGGGTAGG - Intergenic
1113260000 13:108551390-108551412 TGAGGCTTAGAGAGATAGCCAGG - Intergenic
1115115789 14:29879629-29879651 ACTGGGTAAGAGACATAGGTTGG + Intronic
1118302653 14:64629027-64629049 TGTGGCCTGGAGACAGGGGTGGG + Intergenic
1118362328 14:65066748-65066770 GGAGGCTTAGAGGCTTAGGTAGG + Intronic
1118785153 14:69039499-69039521 CTTAGCTTACAGACATAGGTGGG - Intergenic
1119869677 14:78005969-78005991 TGAGGCTTAGAGAGGTAAGTTGG + Intergenic
1119931103 14:78548343-78548365 GGTGGCTTTGAGCTATAGGTTGG + Intronic
1124235206 15:27984176-27984198 TGTGGCTTAGACAGATCTGTAGG - Intronic
1125241085 15:37576818-37576840 TTTGGCCTATATACATAGGTGGG - Intergenic
1127828407 15:62726954-62726976 TGCGGCTTAGTGCCATTGGTGGG + Intronic
1127977705 15:64010518-64010540 TGAGGCTGAGAGACAAATGTAGG - Intronic
1137980862 16:53068424-53068446 TGTGACTGAGAGGCAGAGGTGGG - Intronic
1142823799 17:2494468-2494490 TGTGGCATAGAGACATAAAGTGG - Intronic
1143986103 17:10915830-10915852 TGTGATTTAGACACACAGGTGGG + Intergenic
1151250529 17:72830589-72830611 TGTTGCTTAGAGACAGGGGATGG - Intronic
1153656278 18:7285377-7285399 TGTCCCTCAGAGACATAGGAGGG - Intergenic
1154496786 18:14967148-14967170 TGTGGCTTAGAGTCAGATGATGG + Intergenic
1156351326 18:36303767-36303789 GCTGGCTTAGAGGCATAGCTGGG + Intronic
1156789770 18:40956609-40956631 TTTGGCACAGAGAAATAGGTTGG + Intergenic
1158539753 18:58342384-58342406 TGTGTCTTAGAGACAGCTGTGGG + Intronic
1161364388 19:3869587-3869609 TGGGGCTCGGAGACAGAGGTAGG - Intergenic
1163866220 19:19775711-19775733 AGTGTCTTAGAGACACAGGTGGG - Intergenic
1163895303 19:20053104-20053126 AGTGTCTCAGAGACACAGGTGGG + Intergenic
1164118110 19:22241435-22241457 TGTGGCTCTGATCCATAGGTGGG - Intergenic
1166331037 19:42078128-42078150 TGTGGCTGGGAGAAACAGGTGGG + Intronic
1167107086 19:47436703-47436725 TGAGGCTCAGAGACAGAGGAGGG - Intronic
1168336130 19:55598903-55598925 TGTGGCTTAGAGAAGTAGGTAGG - Intronic
926092886 2:10061814-10061836 TGGGGCTTAGAGAGCCAGGTGGG + Intronic
926145236 2:10393270-10393292 TGTGGCTTAGAGATAGAGCCAGG + Intronic
926685518 2:15694945-15694967 TGTGGCTGAGAGATAGAGGTGGG + Intronic
927201705 2:20582380-20582402 AGTGGCTGAGAGAGATTGGTAGG + Intronic
932370900 2:71186967-71186989 TGTGGCTGTGGGACAGAGGTTGG - Exonic
936084753 2:109459657-109459679 TGTGGCTTAGAATCAAAGGCAGG - Intronic
940245630 2:151612345-151612367 AGTGGCTGAGAGGCATAGGATGG - Exonic
940248800 2:151650335-151650357 AGTGGCTGAGAGGCATAGGATGG - Exonic
948162974 2:235840331-235840353 AGTGGCTTAGAGACATAACACGG + Intronic
1178355439 21:31907426-31907448 TGTGGCTTACAGATCTTGGTTGG + Intronic
1184015354 22:41781862-41781884 TGTGGCTTTGAGGCATGGGGTGG + Intronic
954474785 3:50734149-50734171 TGTTGCTTTGAAAGATAGGTAGG - Intronic
955612582 3:60773633-60773655 TGTGGCTTAATTACATAGCTTGG - Intronic
962236820 3:133713864-133713886 TGTGGCTTTGAGACAGAAGAGGG - Intergenic
962689612 3:137880847-137880869 TATGGCTTAGACAAAAAGGTTGG + Intergenic
964144546 3:153443178-153443200 TTTGTCTTAGATAGATAGGTAGG - Intergenic
965134937 3:164752147-164752169 TGAGGCTTACAGATATATGTAGG - Intergenic
969214047 4:5708824-5708846 TGAGGCTTACAGACCCAGGTAGG - Intronic
969223832 4:5781363-5781385 TGTGGCTTAGATACCCTGGTAGG + Intronic
969944956 4:10773913-10773935 TGTAACTTAGGGACATAGGGAGG + Intergenic
970548739 4:17157179-17157201 TGTGGATTCCAGACATAGCTAGG - Intergenic
970913522 4:21306792-21306814 TGGGGCTGAGAAACATATGTAGG + Intronic
972843566 4:42960069-42960091 TGTGTCTTAGAGACACAGAAAGG + Intronic
979495646 4:121380012-121380034 TGTGGCTTAGAGACATAGGTTGG - Intronic
979513639 4:121582531-121582553 TGTGGCTCAGAGAAAAAGGTGGG - Intergenic
982884125 4:160756643-160756665 TGTGTTTTAGGAACATAGGTTGG + Intergenic
983348539 4:166558469-166558491 AGTGGCTAACAGACAGAGGTTGG + Intergenic
984708931 4:182868534-182868556 GCTGGCTCAGAGACATAGGTTGG - Intergenic
985987379 5:3527439-3527461 TGTGGCTTATAGAAAAAGGCAGG + Intergenic
987403322 5:17500252-17500274 TGTGTCTTAGAGACACAAGGAGG + Intergenic
987410153 5:17606802-17606824 TGTGTCTTAGAGACACAAGGAGG + Intergenic
987413365 5:17636479-17636501 TGTGTCTTAGAGACACAAGGAGG + Intergenic
987494614 5:18627786-18627808 TGGGGATTAGAGGCATAGCTAGG + Intergenic
988597475 5:32608109-32608131 TGGGGCTCAGAGACTTAAGTTGG - Intergenic
990273521 5:54171421-54171443 TGTGGCCAAGAAACATAGGCTGG + Intronic
992594466 5:78331659-78331681 TGGGGATTAGAGAAATAGATAGG + Intergenic
993057616 5:83000634-83000656 TGTGGCTTAGAAACTCAGGCAGG - Intergenic
996598838 5:125237401-125237423 TTTTGCTTAGAGATTTAGGTTGG + Intergenic
998127867 5:139636344-139636366 TCTGGCTCAGAGACCTTGGTGGG - Intergenic
999672995 5:153973960-153973982 TGTGGCTTGGAGAGATGGGCGGG + Intergenic
999836809 5:155382596-155382618 GGAGGCTTAGAGAGGTAGGTTGG + Intergenic
1006330511 6:33387085-33387107 AGTGGCTTACCAACATAGGTTGG + Intergenic
1013442139 6:110180886-110180908 TGTGGATTAGGGACATAGCCTGG + Intronic
1014361243 6:120478025-120478047 AGTCTCTTAGAGACATAGTTGGG + Intergenic
1017622769 6:156316110-156316132 TGTGGCTTATATACATAAGTAGG - Intergenic
1017710019 6:157159083-157159105 TGTGGATTAGAGCCACAGGGGGG - Intronic
1023468363 7:40484623-40484645 TGAGGCTTAGAGAAGTAGATAGG - Intronic
1027970666 7:85076714-85076736 TGTAGCTCAGAGACAGAGATAGG - Intronic
1031292678 7:119957504-119957526 AGTGGCCTAGAGACAGAAGTAGG + Intergenic
1031558710 7:123210482-123210504 TGTGGCTTGTAGACATATGTAGG - Intergenic
1034446981 7:151118759-151118781 TGTTGCTTGGAAACATTGGTTGG + Intronic
1035769494 8:2135728-2135750 TGTTGTTTAGAGACATAAATGGG - Intronic
1039399014 8:37252813-37252835 TGTGGCTTAGAGAGATTGGGTGG + Intergenic
1040278871 8:46027639-46027661 TGTGGCCTTGAGAGAAAGGTGGG - Intergenic
1047317516 8:123748081-123748103 TGTGGGTTAGAGACATATTTGGG + Intergenic
1047992518 8:130300953-130300975 TGTGCCTTCCAGACATAGGATGG - Intronic
1050100418 9:2113305-2113327 TGTTGGTTAGAAACATGGGTTGG + Intronic
1060042840 9:120315622-120315644 AGTGTCTCAGAGACACAGGTGGG - Intergenic
1061992432 9:134166761-134166783 TGTGGTCTAGAGACATTTGTGGG - Intergenic
1188934739 X:36160346-36160368 TGTGGCTAAGAGATATGGCTGGG + Intergenic
1189657015 X:43255015-43255037 TGTGGCTAAGACACATCTGTAGG + Intergenic
1192188975 X:68979122-68979144 TGGGGCTTAAAGACTGAGGTGGG + Intergenic
1195977074 X:110538797-110538819 TGTGGTATTGATACATAGGTAGG + Intergenic