ID: 979495806

View in Genome Browser
Species Human (GRCh38)
Location 4:121380962-121380984
Sequence GGTGCTGGAGCGCCACGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979495793_979495806 17 Left 979495793 4:121380922-121380944 CCCTTGCTCTTCCCTAAGGCGAG 0: 1
1: 0
2: 1
3: 9
4: 106
Right 979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 67
979495797_979495806 5 Left 979495797 4:121380934-121380956 CCTAAGGCGAGGCGCCGCCACGG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 67
979495794_979495806 16 Left 979495794 4:121380923-121380945 CCTTGCTCTTCCCTAAGGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 104
Right 979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 67
979495796_979495806 6 Left 979495796 4:121380933-121380955 CCCTAAGGCGAGGCGCCGCCACG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 67
979495803_979495806 -9 Left 979495803 4:121380948-121380970 CCGCCACGGTCTGGGGTGCTGGA 0: 1
1: 0
2: 2
3: 6
4: 115
Right 979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979495806 Original CRISPR GGTGCTGGAGCGCCACGCGA GGG Exonic
900154470 1:1198440-1198462 GGAGCTGGAGCGCCAGGCTTGGG - Intergenic
919639394 1:200034427-200034449 GGTCCTGGAGTGCCCCGCCAGGG - Intronic
1063393623 10:5666400-5666422 GGTGGTGGCGCGCCCCGCGCTGG - Intronic
1069716870 10:70526723-70526745 GGTGCTGGAGAGCCATGCTGGGG + Intronic
1077192297 11:1260514-1260536 GGTCCTGGAGGGCCATGGGAGGG + Intronic
1077916040 11:6612079-6612101 GGTGCTGGAGGGCAGCGCGGCGG + Exonic
1083662038 11:64255921-64255943 GGTCCTGGAGCGCCAGGGGGCGG + Intronic
1085313144 11:75527805-75527827 GGGGCTGGAACGCCAGGCTAGGG - Intergenic
1089771664 11:120807493-120807515 GGAGCTGGAACGCTACGCGCCGG - Intronic
1101773783 12:107775596-107775618 GCTGCTGGAGCGCCAGGCCTGGG + Exonic
1102245500 12:111353281-111353303 GGGGCTGGAGAGCAACGAGAAGG + Intergenic
1105943201 13:25169735-25169757 GTTGCTGGTGCACCACGGGATGG + Exonic
1113876933 13:113600529-113600551 GGTCCTGGATCCCCACGTGAGGG - Intronic
1113876968 13:113600738-113600760 GGTCCTGGAGCCCTACGTGAGGG - Intronic
1114672171 14:24417137-24417159 GCTGCTGGAGCTCCACTGGAGGG + Exonic
1122776714 14:104120105-104120127 GCTGCTGGAGGGCCACGCCGGGG + Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1132314693 15:100880862-100880884 GGTCCGGGAGCGCGACCCGATGG + Intronic
1136751224 16:32637800-32637822 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1141948204 16:87324542-87324564 GGTGCTGGAGGGCCAGGGGGAGG - Intronic
1203053358 16_KI270728v1_random:897055-897077 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1151559038 17:74861090-74861112 GGTGCTGCCGCGCCAAGCGAAGG + Intronic
1151745422 17:76009238-76009260 GGAGGTGGTGCGCCACGAGAAGG - Exonic
1152274628 17:79349123-79349145 GATGATGGAGCGCCAGGCGTGGG - Intronic
1161041685 19:2113814-2113836 GGTTCTGGAGCTGCACGTGAGGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163778072 19:19229498-19229520 GGTGCTGGGGAGCCATGCAAGGG + Intronic
1163797883 19:19347802-19347824 GGTTCAGAAGCGCCACGTGAGGG - Intronic
1166091661 19:40513213-40513235 GGTGCTGGCGCGCCAGGCGGCGG - Exonic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
932536549 2:72603358-72603380 GGTGCTGGGGGGCCAGGGGAGGG - Intronic
947341059 2:229140060-229140082 GGTCCTGGAGTACCACGCTAAGG - Intronic
947792399 2:232875900-232875922 GGTGCTGGGGCCCCAGGTGACGG - Intronic
1176062178 20:63177270-63177292 GGTGCAGGAGGGCCATGTGAGGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1178488064 21:33031245-33031267 GGTGCTGCAGAGCCACGCAGTGG - Intergenic
1180074539 21:45455988-45456010 GGTGCTGGAAGGCCCAGCGAGGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1182282809 22:29226890-29226912 GGTGATGGAGCCCCATGGGAGGG - Intronic
1182295760 22:29310637-29310659 GGTGCTGAGGAGCCACGTGATGG + Exonic
1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
960036097 3:113104572-113104594 AATGCTGGACCGCCAAGCGAGGG + Intergenic
964622575 3:158732139-158732161 GGTGCAGGAGGGCCGCGCGTGGG - Exonic
968021436 3:195394172-195394194 GGTGCTGGAGGGGCACGGGAGGG - Intronic
969457555 4:7308749-7308771 GGTGCTGGAGCGAGACGACAGGG - Intronic
976569815 4:86594743-86594765 GCTACTGGAGCGCCGGGCGAGGG - Exonic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
982235621 4:153249025-153249047 GTTGCTGGAGGGCCAGGCGGGGG + Intronic
985445457 4:190019004-190019026 GGAGCTGGAGAGCCAGGGGAAGG + Intergenic
988065771 5:26227959-26227981 GGAGCTGGAGATCCAGGCGAGGG - Intergenic
997248218 5:132369687-132369709 GGAGCTGGGGCGGGACGCGAGGG - Intergenic
1002336580 5:178483471-178483493 GGTGCTGGAAAGCCAGGAGAAGG - Intronic
1002690241 5:181045427-181045449 GGTGCTGGAGCGACGTGCAAAGG - Intronic
1002757933 6:179360-179382 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1004204050 6:13574851-13574873 TGTGCTGGGGAGCCCCGCGAGGG + Intronic
1006510499 6:34518716-34518738 GGTGGTGGAGAGCCACTGGAAGG - Intronic
1007789585 6:44301422-44301444 GCTGCTGGAGCGGCACTCGAAGG - Exonic
1019612097 7:1941758-1941780 GGGGCTGGAGCGACCTGCGATGG + Intronic
1023888642 7:44377518-44377540 GCTGCTGGAGCCCCATGGGAAGG - Intergenic
1025850524 7:65239864-65239886 GGTGCCGGAGCGGGACGCGGGGG - Intergenic
1029736918 7:102470111-102470133 GGTGCTGAAGCCCCAGGTGAAGG - Intronic
1035084866 7:156249421-156249443 GGGCCTGGAGCACCACGAGAAGG + Intergenic
1039283803 8:36016913-36016935 GGTGCTGGAGGGCCTTGCTAAGG + Intergenic
1049351189 8:142165623-142165645 GCTCCTGGAGCGCCACTGGAGGG + Intergenic
1049830773 8:144699636-144699658 GGTGCTGGTGGGCTACGGGACGG + Intergenic
1057910306 9:99015250-99015272 AATGCTGGAGCTCCAGGCGAAGG + Intronic
1059538075 9:115102226-115102248 TGTGCTGGAGGGCCAAGCAAAGG + Intronic
1196791416 X:119468383-119468405 GGAGCTGGAGCGGCAGGCGTCGG - Exonic
1199978312 X:152907174-152907196 GGTGCTGGAGCGTGAGGAGATGG - Intergenic