ID: 979503209

View in Genome Browser
Species Human (GRCh38)
Location 4:121463340-121463362
Sequence GGTTAGCCTGGGAACCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979503209_979503214 21 Left 979503209 4:121463340-121463362 CCACTCAGGTTCCCAGGCTAACC No data
Right 979503214 4:121463384-121463406 CAATTTCTGAAGCAGTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979503209 Original CRISPR GGTTAGCCTGGGAACCTGAG TGG (reversed) Intergenic
No off target data available for this crispr