ID: 979503439

View in Genome Browser
Species Human (GRCh38)
Location 4:121466675-121466697
Sequence CTTTCTAGGGAGAGCAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979503434_979503439 17 Left 979503434 4:121466635-121466657 CCAAGAGGGTATGAAAAGGTTTA No data
Right 979503439 4:121466675-121466697 CTTTCTAGGGAGAGCAAGGCCGG No data
979503432_979503439 26 Left 979503432 4:121466626-121466648 CCATACACACCAAGAGGGTATGA No data
Right 979503439 4:121466675-121466697 CTTTCTAGGGAGAGCAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979503439 Original CRISPR CTTTCTAGGGAGAGCAAGGC CGG Intergenic
No off target data available for this crispr