ID: 979509690

View in Genome Browser
Species Human (GRCh38)
Location 4:121538193-121538215
Sequence AGCAACTTGGATGGAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18766
Summary {0: 255, 1: 1104, 2: 3654, 3: 6523, 4: 7230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979509690_979509696 9 Left 979509690 4:121538193-121538215 CCTCCAGCTCCATCCAAGTTGCT 0: 255
1: 1104
2: 3654
3: 6523
4: 7230
Right 979509696 4:121538225-121538247 CATTATTTCATTCCTTAGTATGG No data
979509690_979509698 27 Left 979509690 4:121538193-121538215 CCTCCAGCTCCATCCAAGTTGCT 0: 255
1: 1104
2: 3654
3: 6523
4: 7230
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979509690 Original CRISPR AGCAACTTGGATGGAGCTGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr