ID: 979509691

View in Genome Browser
Species Human (GRCh38)
Location 4:121538196-121538218
Sequence GGCAGCAACTTGGATGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14371
Summary {0: 6, 1: 260, 2: 1189, 3: 4271, 4: 8645}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979509691_979509696 6 Left 979509691 4:121538196-121538218 CCAGCTCCATCCAAGTTGCTGCC 0: 6
1: 260
2: 1189
3: 4271
4: 8645
Right 979509696 4:121538225-121538247 CATTATTTCATTCCTTAGTATGG No data
979509691_979509698 24 Left 979509691 4:121538196-121538218 CCAGCTCCATCCAAGTTGCTGCC 0: 6
1: 260
2: 1189
3: 4271
4: 8645
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979509691 Original CRISPR GGCAGCAACTTGGATGGAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr