ID: 979509692

View in Genome Browser
Species Human (GRCh38)
Location 4:121538202-121538224
Sequence GCTTTTGGCAGCAACTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979509692_979509698 18 Left 979509692 4:121538202-121538224 CCATCCAAGTTGCTGCCAAAAGC No data
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359
979509692_979509696 0 Left 979509692 4:121538202-121538224 CCATCCAAGTTGCTGCCAAAAGC No data
Right 979509696 4:121538225-121538247 CATTATTTCATTCCTTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979509692 Original CRISPR GCTTTTGGCAGCAACTTGGA TGG (reversed) Intergenic
No off target data available for this crispr