ID: 979509693

View in Genome Browser
Species Human (GRCh38)
Location 4:121538206-121538228
Sequence AATGGCTTTTGGCAGCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979509693_979509698 14 Left 979509693 4:121538206-121538228 CCAAGTTGCTGCCAAAAGCCATT No data
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359
979509693_979509696 -4 Left 979509693 4:121538206-121538228 CCAAGTTGCTGCCAAAAGCCATT No data
Right 979509696 4:121538225-121538247 CATTATTTCATTCCTTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979509693 Original CRISPR AATGGCTTTTGGCAGCAACT TGG (reversed) Intergenic
No off target data available for this crispr