ID: 979509696

View in Genome Browser
Species Human (GRCh38)
Location 4:121538225-121538247
Sequence CATTATTTCATTCCTTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979509690_979509696 9 Left 979509690 4:121538193-121538215 CCTCCAGCTCCATCCAAGTTGCT 0: 255
1: 1104
2: 3654
3: 6523
4: 7230
Right 979509696 4:121538225-121538247 CATTATTTCATTCCTTAGTATGG No data
979509692_979509696 0 Left 979509692 4:121538202-121538224 CCATCCAAGTTGCTGCCAAAAGC No data
Right 979509696 4:121538225-121538247 CATTATTTCATTCCTTAGTATGG No data
979509691_979509696 6 Left 979509691 4:121538196-121538218 CCAGCTCCATCCAAGTTGCTGCC 0: 6
1: 260
2: 1189
3: 4271
4: 8645
Right 979509696 4:121538225-121538247 CATTATTTCATTCCTTAGTATGG No data
979509693_979509696 -4 Left 979509693 4:121538206-121538228 CCAAGTTGCTGCCAAAAGCCATT No data
Right 979509696 4:121538225-121538247 CATTATTTCATTCCTTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979509696 Original CRISPR CATTATTTCATTCCTTAGTA TGG Intergenic
No off target data available for this crispr