ID: 979509698

View in Genome Browser
Species Human (GRCh38)
Location 4:121538243-121538265
Sequence TATGGCTGAGTAGTATTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54278
Summary {0: 793, 1: 2575, 2: 28071, 3: 15480, 4: 7359}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979509693_979509698 14 Left 979509693 4:121538206-121538228 CCAAGTTGCTGCCAAAAGCCATT No data
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359
979509690_979509698 27 Left 979509690 4:121538193-121538215 CCTCCAGCTCCATCCAAGTTGCT 0: 255
1: 1104
2: 3654
3: 6523
4: 7230
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359
979509694_979509698 3 Left 979509694 4:121538217-121538239 CCAAAAGCCATTATTTCATTCCT No data
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359
979509691_979509698 24 Left 979509691 4:121538196-121538218 CCAGCTCCATCCAAGTTGCTGCC 0: 6
1: 260
2: 1189
3: 4271
4: 8645
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359
979509695_979509698 -4 Left 979509695 4:121538224-121538246 CCATTATTTCATTCCTTAGTATG No data
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359
979509692_979509698 18 Left 979509692 4:121538202-121538224 CCATCCAAGTTGCTGCCAAAAGC No data
Right 979509698 4:121538243-121538265 TATGGCTGAGTAGTATTCCATGG 0: 793
1: 2575
2: 28071
3: 15480
4: 7359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979509698 Original CRISPR TATGGCTGAGTAGTATTCCA TGG Intergenic
Too many off-targets to display for this crispr