ID: 979518928

View in Genome Browser
Species Human (GRCh38)
Location 4:121643648-121643670
Sequence CAGTGTAAATAAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979518928_979518934 -8 Left 979518928 4:121643648-121643670 CCCTCTTCCCTTTATTTACACTG No data
Right 979518934 4:121643663-121643685 TTACACTGGCCCTAGAAAGGTGG No data
979518928_979518939 24 Left 979518928 4:121643648-121643670 CCCTCTTCCCTTTATTTACACTG No data
Right 979518939 4:121643695-121643717 GGTTAACTGATTGCTAAATTTGG No data
979518928_979518938 3 Left 979518928 4:121643648-121643670 CCCTCTTCCCTTTATTTACACTG No data
Right 979518938 4:121643674-121643696 CTAGAAAGGTGGAGTCAGTTGGG No data
979518928_979518937 2 Left 979518928 4:121643648-121643670 CCCTCTTCCCTTTATTTACACTG No data
Right 979518937 4:121643673-121643695 CCTAGAAAGGTGGAGTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979518928 Original CRISPR CAGTGTAAATAAAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr