ID: 979521158

View in Genome Browser
Species Human (GRCh38)
Location 4:121668552-121668574
Sequence ATGGCTTCTGTGAGTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979521158_979521161 3 Left 979521158 4:121668552-121668574 CCTCCATGACTCACAGAAGCCAT 0: 1
1: 0
2: 2
3: 27
4: 270
Right 979521161 4:121668578-121668600 AAATTTTAAAACTAAATAACTGG 0: 1
1: 1
2: 16
3: 158
4: 1409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979521158 Original CRISPR ATGGCTTCTGTGAGTCATGG AGG (reversed) Intronic
900924060 1:5692054-5692076 AGGCCATCTGTGAGTCATGCAGG - Intergenic
901981287 1:13036097-13036119 ATCGCATCTATGAGTCTTGGTGG - Intronic
902000798 1:13192832-13192854 ATCGCATCTATGAGTCTTGGTGG + Intergenic
902372068 1:16013384-16013406 GTGGAATCAGTGAGTCATGGAGG + Intergenic
903640718 1:24858139-24858161 AAGGCTGCTGTGAGCCATGATGG - Intergenic
903847864 1:26289241-26289263 AGGGCTGCTGTGAGGCTTGGAGG + Intronic
904265049 1:29313300-29313322 ATGGCCTCTGTGTCTCATTGCGG + Intronic
904676836 1:32204037-32204059 AGGCCTTCGGTGAGTCCTGGGGG + Exonic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
904772462 1:32887776-32887798 ATGGCATGTGTGAGACATGTGGG + Intronic
904878791 1:33678479-33678501 ATCGCTGATGTGAGTCATGATGG + Intronic
905218771 1:36429602-36429624 ATGGCTGCAGTGAGCCATGGTGG - Intronic
905392259 1:37644364-37644386 AAGGCTGCAGTGAGCCATGGTGG - Intergenic
905457699 1:38099858-38099880 TGGGCTTCTGTGTGTCATGCGGG + Intergenic
905681156 1:39871966-39871988 AAGGCTGCAGTGAGTCATGATGG - Intronic
906207382 1:43994381-43994403 AAGGCTACAGTGAGTCATGATGG + Intronic
906656867 1:47554490-47554512 AGGGCTTCTGGGGATCATGGAGG + Intergenic
908251714 1:62271208-62271230 GTGGCTTCTGGGAGTTTTGGGGG - Intronic
908844712 1:68312817-68312839 TTGGCTTCTTTGAGTTTTGGAGG - Intergenic
909365063 1:74811408-74811430 ATGGCTTCAGTGTGTTATGAGGG - Intergenic
910598522 1:89005522-89005544 ATGGCTGCTGTGGGGGATGGGGG + Intergenic
911566411 1:99467563-99467585 CAGGACTCTGTGAGTCATGGCGG + Intergenic
911955938 1:104235225-104235247 ATGGTTTCTGTGGGTCGGGGTGG + Intergenic
914238129 1:145831032-145831054 AAGGCTTCAGTGAGCCATGATGG + Intronic
915292014 1:154890875-154890897 AAGGCTGCAGTGAGCCATGGTGG - Intergenic
917246137 1:173003368-173003390 GAGGCTGCTGTGAGTCATGATGG + Intergenic
919520588 1:198582790-198582812 TTGGCTGCTGTGGGGCATGGAGG + Intergenic
920461251 1:206142230-206142252 ATGGCTCCTCTGAGTGCTGGGGG - Intergenic
920532493 1:206713971-206713993 ATTGCTTCTGTGGGTGACGGAGG + Intronic
920618223 1:207516155-207516177 AAGGCTTCAGTGAGTTATGATGG + Intronic
920708984 1:208277160-208277182 AGGGCCTCTGTGAGCCATGTAGG + Intergenic
922140155 1:222876242-222876264 ATGGCTGTGGTCAGTCATGGTGG + Intronic
924354260 1:243152982-243153004 AGGACTTCTGTGATTCATGGAGG + Intronic
1063094011 10:2893253-2893275 ATGAAATCTGTGATTCATGGAGG + Intergenic
1063510980 10:6645408-6645430 ATTGCTGCTGTGAGTAATAGAGG - Intergenic
1064778491 10:18806892-18806914 AAGGCTGCTGTGAGGCATGATGG - Intergenic
1065861249 10:29873880-29873902 TTGGCTTCTGTAAGCCAAGGTGG - Intergenic
1066044700 10:31584829-31584851 AAAGGTTCTGTGAGTCAGGGTGG + Intergenic
1066238012 10:33505885-33505907 ATGGATACCGTGAGTTATGGGGG + Intergenic
1068486024 10:57659779-57659801 ATGCCTTTTGTGATTCAGGGTGG - Intergenic
1071450447 10:85787899-85787921 ATGGATTCTGTGAGCCACTGGGG - Intronic
1071501466 10:86207148-86207170 ATGGCTTCTGAAAGTCAGAGAGG + Intronic
1072983984 10:100123405-100123427 AAGGCTGCAGTGAGCCATGGTGG - Intergenic
1072999374 10:100275487-100275509 TTGGCTTCTGTGAGGGATGAGGG + Exonic
1073379398 10:103066384-103066406 ATGGCTTCTTCGAATCATGCTGG + Intronic
1073721886 10:106182152-106182174 AAGGTTTCTCTGAGTCAAGGTGG + Intergenic
1073807860 10:107118997-107119019 ATGACCTGTGTGAGTCATGTGGG - Intronic
1075204700 10:120436946-120436968 ATCGGATCTGAGAGTCATGGAGG + Intergenic
1076334442 10:129696051-129696073 GTGTCTGCTGTGTGTCATGGGGG + Intronic
1076598546 10:131641619-131641641 GTGGCTCCTGTGAGTCTTGTGGG - Intergenic
1076612354 10:131734259-131734281 CTGGCATCTCTGAGTCGTGGAGG - Intergenic
1076666311 10:132094903-132094925 GTGGCTGCTGTGGGGCATGGGGG + Intergenic
1077564039 11:3284957-3284979 AAGGCTACTGTGAGTCACCGAGG - Intergenic
1077569929 11:3330774-3330796 AAGGCTACTGTGAGTCACCGAGG - Intergenic
1078933527 11:15931302-15931324 ATGTCTGCTGTCAGCCATGGAGG - Intergenic
1079531762 11:21462717-21462739 ATGACTTCTGAGAGTCAAGGAGG + Intronic
1084440089 11:69167831-69167853 ATGGCTCCTGGGAGTGATGTAGG + Intergenic
1086292177 11:85324154-85324176 ATGGCTTCTCTGAATTATGTAGG + Intronic
1087214482 11:95480689-95480711 TTGGCCACTGTTAGTCATGGTGG + Intergenic
1087381048 11:97405505-97405527 ATGGCATCTGTCATTCCTGGGGG - Intergenic
1089270062 11:117295930-117295952 AGGGCTTCTGTGTGTGGTGGGGG + Intronic
1089419003 11:118316823-118316845 GTGGCTTCTGGGAGTGAGGGTGG + Intergenic
1089911227 11:122102455-122102477 ATGGATTTTGTGAATCTTGGTGG + Intergenic
1090307267 11:125702267-125702289 ATGGCTGCTGTGGGGTATGGGGG - Intergenic
1093936207 12:25003413-25003435 AGGGCTTCAGTGAGCCATGAAGG - Intergenic
1094295461 12:28900014-28900036 ATGGATTCTCTTAGTCATTGTGG - Intergenic
1094337891 12:29381137-29381159 CGGGCTTCTGTGAAACATGGCGG - Exonic
1094605328 12:31944433-31944455 ATGGTCTGTGTGAGTCATGGGGG - Intergenic
1096743512 12:53711247-53711269 GTGCCTTCTGTGAGGAATGGGGG - Intronic
1097386165 12:58952199-58952221 ATTTCTTCTGTGAGTTATTGAGG + Intergenic
1099194580 12:79600535-79600557 AAGGCTGCAGTGAGCCATGGTGG - Intronic
1100551461 12:95649998-95650020 CTGGCTTCTTTGGGTCATGAAGG + Intergenic
1104295454 12:127507880-127507902 ATGTCTTCTGTTTCTCATGGAGG + Intergenic
1104752027 12:131245932-131245954 CTGGCTTCTTTCAGACATGGTGG - Intergenic
1105356472 13:19664046-19664068 AAGGCATCAGTGAGTCATGATGG - Intronic
1107247267 13:38311095-38311117 ATTGCTTCTATAAGTCTTGGTGG - Intergenic
1108589212 13:51897261-51897283 AGGGCTACAGTGAGTCATGATGG - Intergenic
1109293417 13:60501543-60501565 ATGGTCTGTGTAAGTCATGGAGG - Intronic
1112092347 13:96094709-96094731 ATGGATTATGTGGGTCATGAAGG + Intronic
1114740840 14:25095754-25095776 CTGGCCTCTGTGAGTCTTGGGGG - Intergenic
1117455190 14:55890089-55890111 GAGGCTTCAGTGAGTCATGATGG - Intergenic
1117611764 14:57490505-57490527 CTGGCCTCTGTGAGTCTTTGGGG + Intronic
1118751774 14:68813063-68813085 ATGGCTTCTGTGACACTTGAAGG - Intergenic
1119116690 14:72028692-72028714 AAGGCTTAGGTGATTCATGGTGG + Intronic
1120029894 14:79629526-79629548 AGGGTATCTGTGAATCATGGTGG + Intronic
1125008594 15:34845968-34845990 GAGGCTGCTGTGAGCCATGGTGG - Intergenic
1127102290 15:55578955-55578977 TTGCCTTCTGTGAGTCACTGAGG - Intronic
1127798623 15:62458702-62458724 AAGGCTACAGTGAGCCATGGTGG + Intronic
1128735016 15:70048586-70048608 AAGGCCGCTGTGAGTCCTGGTGG - Exonic
1129185195 15:73901874-73901896 AAGGCTGCAGTGAGCCATGGTGG - Intergenic
1129383932 15:75185351-75185373 AAGGCTGCAGTGAGCCATGGTGG + Intergenic
1131070630 15:89463509-89463531 ATGGTTTGTGTGTGTCATGCGGG + Intergenic
1131983129 15:98015300-98015322 ATTGCTTCTGTGACAAATGGTGG + Intergenic
1132081304 15:98868260-98868282 AAGGCTTCAGTGAGCCATGATGG + Intronic
1132112092 15:99109086-99109108 ATAGCTTCTGTGGCTCAAGGGGG + Intronic
1132790896 16:1687045-1687067 AAGGCTGCAGTGAGTCATGGTGG - Intronic
1133390211 16:5404055-5404077 TTGGCTTGTCTGAGTCATGGGGG + Intergenic
1133781529 16:8942610-8942632 ATGGCTGCAGTGAGCCATGGTGG - Intronic
1134428660 16:14179290-14179312 ATGGGATCTATGAGTCATGATGG - Intronic
1134452097 16:14370002-14370024 AAGGCTTCAGTGAGGCATGGAGG + Intergenic
1135783262 16:25324926-25324948 TCTGCTTCTGTGAGTGATGGAGG + Intergenic
1136145357 16:28313228-28313250 GAGGCTTCAGTGAGCCATGGGGG + Intronic
1136404201 16:30034211-30034233 AAGGCTGCAGTGAATCATGGTGG + Intronic
1138475096 16:57265959-57265981 AAGGCTGCAGTGAGTCATGATGG + Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1142527160 17:551500-551522 AAGGCTGCAGGGAGTCATGGTGG + Intronic
1143182040 17:4989388-4989410 CTGGGTTCTGGGAGTCATGCAGG - Intronic
1143403307 17:6659647-6659669 AAGGCTGCAGTGAGCCATGGTGG + Intergenic
1144419390 17:15082314-15082336 AAGGCTTCTGTGTGTTATGAGGG - Intergenic
1147339794 17:39746549-39746571 AAGGCTGCAGTGAGCCATGGTGG + Intronic
1147448198 17:40487796-40487818 AGGGCTCCTGGGAGTCATGGGGG - Intronic
1147917680 17:43898467-43898489 CTGCCTTCTGTGGGACATGGGGG - Intronic
1148565433 17:48630016-48630038 ATAACCTCTGTGAGTGATGGAGG + Intronic
1148834205 17:50456998-50457020 GAGGCTTCAGTGAGCCATGGTGG + Intronic
1150325647 17:64254924-64254946 AAGGCTGCTGTGAGCCATGATGG - Intronic
1151848733 17:76676841-76676863 AAGGCTGCAGTGAGTCATGATGG + Exonic
1152346293 17:79754111-79754133 AAGGCTGCTGTGAGCCATGATGG + Intergenic
1152557093 17:81058875-81058897 AGGGCCTCTGTCAGTCAAGGGGG - Intronic
1156125260 18:33897452-33897474 ATGTCTTTTGTGGGACATGGAGG + Intronic
1162998078 19:14348982-14349004 GAGGCTGCTGTGAGTCATGATGG + Intergenic
1164999476 19:32749208-32749230 TTGGCCCCTGTGAGCCATGGGGG + Intronic
1165622175 19:37257256-37257278 ATGTCTTCTGGGAGACATAGTGG - Intergenic
1167273663 19:48521658-48521680 AAGGCTACAGTGAGCCATGGTGG - Intergenic
1167729312 19:51241770-51241792 AAGGCTGCAGTGAGTCATGATGG - Intronic
925303896 2:2835850-2835872 TTGGGTTCTGTGGGCCATGGAGG - Intergenic
925431961 2:3802392-3802414 ATGGCTTCTTTCAGCCCTGGAGG + Intronic
925913238 2:8586877-8586899 AGGGCTGCTGTGATTCATGGTGG + Intergenic
927680910 2:25138403-25138425 AAGGCTACTGGGAGTCAGGGTGG + Intronic
929641682 2:43586644-43586666 ATGGCTTGTATGAGTCATTTTGG - Intronic
931658904 2:64538153-64538175 ATTTCTTCTGTGAGTCATAGGGG + Intronic
932781670 2:74562393-74562415 ATGGCTGCTGTTAGCCAAGGGGG - Exonic
933204292 2:79487554-79487576 GTGGCCTCTGTGAGTTATGTAGG - Intronic
933467247 2:82668958-82668980 TTGGCTTCTCTGAGCCATGTTGG + Intergenic
937892823 2:126952402-126952424 GTGGCATCTGTGAGTCATATGGG - Intergenic
938990761 2:136626885-136626907 ATGGCTCCTGTTAGGCATAGTGG - Intergenic
939809882 2:146818318-146818340 AATGCATCAGTGAGTCATGGAGG + Intergenic
941781725 2:169452689-169452711 AAGGCTTCAGTGAGTCATGATGG + Intergenic
943809181 2:192162663-192162685 ATAGCTCCTGTGAGTCTTAGGGG + Intronic
944095019 2:195956361-195956383 ATGTATTCTGCCAGTCATGGTGG + Intronic
945831297 2:214789478-214789500 AAGGCTTCAGTGAGCCATGATGG + Intronic
946476181 2:220008692-220008714 TTTGCTTGTGAGAGTCATGGAGG + Intergenic
946580100 2:221119152-221119174 ATGACCTCTGTGGGGCATGGTGG - Intergenic
948365757 2:237453438-237453460 GGGGTTTCTGTGATTCATGGCGG - Intergenic
948798471 2:240419273-240419295 ACAGCTTCTGTGAGTCCTGTGGG + Intergenic
1168863211 20:1061117-1061139 CTGTCTTCTGTGGGTCAAGGAGG - Intergenic
1168922414 20:1551427-1551449 TTGGCTTAGGTTAGTCATGGGGG + Intronic
1169731424 20:8789312-8789334 AAGGCTTCAGTGAGCCATGATGG + Intronic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1170727612 20:18943648-18943670 GTGGCTGCTGTGGGTGATGGGGG + Intergenic
1171213071 20:23331738-23331760 ATGGTGCCTGTGAGTCAAGGTGG - Intergenic
1172297022 20:33819592-33819614 AGGGCTTATTTGAGTGATGGAGG + Intronic
1173079839 20:39855145-39855167 TTGGCTACTGTGAATCATGCTGG + Intergenic
1173437714 20:43047929-43047951 AAGGCTGCAGTGTGTCATGGTGG - Intronic
1173670709 20:44796726-44796748 ATGGCCTAAGTGAGGCATGGAGG + Intronic
1174558583 20:51413690-51413712 AAGGCTGCAGTGAGCCATGGTGG + Intronic
1174800130 20:53556675-53556697 AAGGCTGCAGTGAGTCATGATGG - Intergenic
1177516608 21:22159680-22159702 ATGGCTGCAGTGAGCCATGATGG + Intergenic
1177634640 21:23771622-23771644 ATGGCTTTTGTCAGCCATGGTGG + Intergenic
1178038201 21:28608876-28608898 GTGGCTGCTGTGAGGGATGGGGG - Intergenic
1179467019 21:41582588-41582610 ATTGCTTCTGTGCTTCAAGGAGG - Intergenic
1179540093 21:42078472-42078494 CTGGCTTCTGTTGGTGATGGAGG - Intronic
1180571988 22:16732999-16733021 ATAGCTTCAGGGAGTCATGGAGG - Intergenic
1182547925 22:31086232-31086254 CTGGGGTCTGTGTGTCATGGTGG - Intronic
1184193604 22:42911343-42911365 AAGGCTTCAGTGAGCCATGATGG + Intronic
1184231488 22:43160502-43160524 CTGGCTCCTGTGAGTGCTGGAGG + Intronic
1184335272 22:43849163-43849185 ATGCTTTCTGTGAGTTCTGGTGG - Intronic
949259594 3:2090153-2090175 AAGGCTTCAGTGAGCCATGATGG - Intergenic
950338702 3:12222156-12222178 ATGGATTTTGTTAATCATGGGGG + Intergenic
950802721 3:15567505-15567527 ATGGCTTCTGCCAGTCATGGTGG - Intronic
953800175 3:46016777-46016799 AAGGCCTGTGTGAGTCAGGGTGG - Intergenic
953843239 3:46406658-46406680 ATTGGTGCTGTGACTCATGGGGG - Intergenic
954376247 3:50195505-50195527 CTGGCTGCTGTGAGTCCTAGAGG - Exonic
954526479 3:51276300-51276322 GTGGCTTCTCTGAGGCCTGGTGG - Intronic
955528578 3:59848116-59848138 ATGGCTTGTGGGAGCCACGGTGG - Intronic
956847744 3:73198684-73198706 GTGGCTGCTTTGAGGCATGGGGG + Intergenic
957106208 3:75891407-75891429 ATAGCTCCAGGGAGTCATGGAGG + Intergenic
958591519 3:96164338-96164360 ATGGATTCTGTATGTCATGCTGG + Intergenic
958962602 3:100524166-100524188 GTGGCTTCTGTGAGTGCGGGAGG + Intronic
959666754 3:108931633-108931655 ATGGCTTGTGTTAGTGTTGGAGG + Intronic
960756462 3:121019191-121019213 GTGGCTCCTGTGAGGAATGGGGG - Intronic
962089914 3:132232105-132232127 TTGCCTTCTGTGAGATATGGTGG - Intronic
964143659 3:153433022-153433044 ATGGATTTAGGGAGTCATGGGGG - Intergenic
964186323 3:153948770-153948792 AGAGCTTCTCTGAGTCATGTTGG + Intergenic
964745641 3:160010133-160010155 ATGGCTGCAGTGAGTCATGATGG - Intergenic
964745643 3:160010152-160010174 AAGGCTGCTGTGAGCCATGATGG - Intergenic
965617854 3:170613025-170613047 ATACCTTCTGAGAGTCATGGTGG + Intronic
966901323 3:184488318-184488340 AAGGCTGCTGTGAGCTATGGTGG - Intronic
967464579 3:189789339-189789361 ATGCCTTCTGTAAATCGTGGTGG + Intronic
968376703 4:49905-49927 ATGGTGTCTGTGAGTGAGGGGGG + Intergenic
970502372 4:16690924-16690946 ATGGCTTCCTTGAGACATAGGGG - Intronic
970921063 4:21395619-21395641 ATGGTTTATGTGTGTCAGGGAGG - Intronic
972046657 4:34673299-34673321 ATGTTTTCTCTTAGTCATGGTGG + Intergenic
972237652 4:37152439-37152461 TTGGCTACTGTGAGTAATGCCGG - Intergenic
974811802 4:66955663-66955685 AAGGCTGCAGTGAGTCATGATGG - Intergenic
974978333 4:68920343-68920365 AGGGCTTTTGTAACTCATGGTGG - Intergenic
975443758 4:74439752-74439774 ATGGTCTGTGTGAGTCATGGGGG - Intergenic
976233530 4:82871119-82871141 ATGGCTGCAGTGAGCTATGGTGG + Intronic
977630213 4:99234562-99234584 ATGGCTTCAGTGAGTTATTTGGG + Intergenic
979247546 4:118526656-118526678 AGGACATCTGTGATTCATGGAGG - Intergenic
979521158 4:121668552-121668574 ATGGCTTCTGTGAGTCATGGAGG - Intronic
982304997 4:153921791-153921813 TTGGCCTCTGTGCTTCATGGAGG + Intergenic
982553375 4:156830893-156830915 ATGCCTTCTGTGAGTCCTATAGG + Intronic
985712421 5:1436916-1436938 ATGCCTCCTGTGAGGTATGGAGG - Intronic
985760941 5:1748347-1748369 GTGGCATCTATAAGTCATGGGGG + Intergenic
986928794 5:12794063-12794085 ATTCCTTCTGTGAGTCTTAGAGG + Intergenic
988890278 5:35609259-35609281 ATTCCTTCAGTGAGTCATGCCGG - Intergenic
990609888 5:57446313-57446335 TTGGCTCCTGTGAGTCAAGCTGG + Intergenic
991156296 5:63440511-63440533 ATGGCTTATGTGAGTTGTGGGGG - Intergenic
991966944 5:72101995-72102017 ATGGATTGGGTGAGTCATTGTGG + Intergenic
992522510 5:77569530-77569552 ATGGCTTTTGTAAGTCATCCAGG - Intronic
992707467 5:79411418-79411440 ATGGCTGCAGTGAGTCAAGATGG + Intronic
995645831 5:114310260-114310282 GTGGTTTCTGTGCATCATGGTGG - Intergenic
996535905 5:124577572-124577594 AAGGCTTCTGGGAGACATTGGGG - Intergenic
998969300 5:147574210-147574232 CTGGCTTGTGTCAGTCCTGGAGG + Intergenic
998981810 5:147712196-147712218 ATGACTTCTGTGAGTGATTGTGG - Intronic
999068061 5:148713234-148713256 ATAGCTTCTGTGATCGATGGTGG + Intergenic
999367084 5:151030150-151030172 AAGGCTACTGTGAGTGGTGGTGG + Exonic
999394996 5:151221700-151221722 AGGGCTTCTGTGAGACTGGGCGG + Intronic
1000284467 5:159815148-159815170 ATGGCTTCCCAGAGTCTTGGGGG + Intergenic
1002923472 6:1590579-1590601 ATGGAATCTGTGGGTCATGAGGG - Intergenic
1003412244 6:5876023-5876045 ATGGCTGCTGTGTGCAATGGGGG + Intergenic
1003891349 6:10566360-10566382 AAGGCTTCAGTGAGCCATGATGG - Intronic
1007622873 6:43225602-43225624 CTGTCTTGTGTGAGTCATGGGGG - Intergenic
1007828219 6:44617681-44617703 ATTGCTTCTGTGGGTCAAGGAGG + Intergenic
1015647058 6:135403866-135403888 ATGGGTTCTGTGACTGATGCTGG + Intronic
1015863272 6:137702463-137702485 GGGGCGTCTGTTAGTCATGGGGG + Intergenic
1016037007 6:139393587-139393609 ATGGTTTCAGTGAATCCTGGGGG + Intergenic
1016358080 6:143239353-143239375 ATGGGTTCTGTGGGTCGTGAAGG - Intronic
1019325293 7:435268-435290 GTGTCTTCTGTGTGACATGGAGG - Intergenic
1019386588 7:760150-760172 GTGTCTTCTGTGGGTCAGGGCGG + Intronic
1019642561 7:2112120-2112142 ATGGCATCTTTGGCTCATGGAGG - Intronic
1020085833 7:5309665-5309687 GTGGCTGCAGTGAGTCATGATGG - Intronic
1020092125 7:5347598-5347620 AAGGCTGCAGTGAGTTATGGTGG + Intronic
1020355609 7:7271908-7271930 ATGGCTTCTGTGGATCTGGGGGG - Intergenic
1021220084 7:17965379-17965401 ATTGCATCTTTGAGTTATGGAGG + Intergenic
1021469217 7:20982041-20982063 CTGGCTTCTGTGAGTGGAGGTGG + Intergenic
1021839387 7:24710111-24710133 ATGTTTTCTGTGAGTCACTGAGG + Intronic
1022824459 7:33994703-33994725 ATGGATTCTATGTGCCATGGGGG + Intronic
1023373721 7:39535994-39536016 AGGGCTTCTGTAAGACATTGAGG + Intergenic
1024174762 7:46827729-46827751 GTGGCTGCTGTGAGGCATGAGGG - Intergenic
1024573525 7:50745775-50745797 ATGTCTTCTGTGAGTTATTTGGG - Intronic
1025208470 7:57007485-57007507 GTGGCTGCAGTGAGTCATGATGG + Intergenic
1025663479 7:63569393-63569415 GTGGCTGCAGTGAGTCATGATGG - Intergenic
1025729063 7:64093915-64093937 AAGGCTGCAGTGAGACATGGTGG + Intronic
1026553469 7:71387099-71387121 ATTGCTCCTGTGGGTGATGGGGG + Intronic
1027055077 7:75044072-75044094 ATGGCCTCACTGAGACATGGAGG + Intronic
1031124989 7:117763623-117763645 AAGGCTGCAGTGAGTCAAGGTGG - Intronic
1032213523 7:129938343-129938365 AAGGCTTCAGTGAGCCATGATGG + Intronic
1033684995 7:143630813-143630835 ATGGGATTTCTGAGTCATGGGGG + Intronic
1033688168 7:143710032-143710054 ATGGGATTTCTGAGTCATGGGGG + Intronic
1033699618 7:143826808-143826830 ATGGGATTTCTGAGTCATGGGGG - Intergenic
1033702368 7:143853145-143853167 AAGGCTTCAGTGAGCCATGATGG - Exonic
1034290951 7:149931214-149931236 TTGGCTTCTGTAGGTCAGGGAGG + Intergenic
1034380753 7:150690199-150690221 TTGGCTCCTGTGAGTCCAGGTGG + Intronic
1034657430 7:152740768-152740790 AAGGCTGCTGTGAGCCATGATGG - Intergenic
1034815235 7:154166559-154166581 TTGGCTTCTGTAGGTCAGGGAGG - Intronic
1035368064 7:158361361-158361383 ATGGCGTCTGTGGGTCATCCTGG - Intronic
1036767591 8:11558543-11558565 ATGACTTCTCTGAGCCCTGGAGG + Intronic
1037322093 8:17653729-17653751 ATGGCCTCTGTGGGCCATGGTGG - Intronic
1038787618 8:30634609-30634631 ATGGCTTCTCTGCATCTTGGAGG - Intronic
1039105394 8:33984056-33984078 ATGGATTCTGTAAGTTAGGGGGG + Intergenic
1039125612 8:34197823-34197845 CTGGCTTCTGTGAATAATTGGGG + Intergenic
1039410217 8:37348820-37348842 ATGGGTGCTGTGGGTGATGGAGG - Intergenic
1039798984 8:40938210-40938232 ATAGCTTCTGTGGGTCAGTGAGG - Intergenic
1040500977 8:48004891-48004913 AAGGCTTCAGTGAGTTATGATGG - Intergenic
1043556762 8:81439267-81439289 GTGGCTGCTGTGGGGCATGGGGG + Intergenic
1044672205 8:94693782-94693804 TTGGCATCTGTGAGTCATGGAGG + Intronic
1046170820 8:110502731-110502753 ATGGCATGTGTGAGTCGTGGTGG + Intergenic
1047205884 8:122802765-122802787 ATGGGTTGTGTCCGTCATGGGGG + Intronic
1047436696 8:124840685-124840707 AGGGCCTCGGTGGGTCATGGGGG - Intergenic
1048262264 8:132955085-132955107 ATGGCTGCTGTAGGTCCTGGAGG - Intronic
1048973530 8:139658285-139658307 GTGGATGCTGTAAGTCATGGGGG + Intronic
1050336046 9:4590891-4590913 ATGGCTTTCCTGAGTTATGGAGG - Intronic
1051515722 9:17928620-17928642 ATGTGTTCTGTCAGGCATGGTGG + Intergenic
1051633224 9:19159100-19159122 AAGGCTCCAGTGAGCCATGGTGG - Intergenic
1053185449 9:36012524-36012546 TTGGCTTCTGTGAGGCATTTGGG + Intergenic
1056026044 9:82496279-82496301 ATGGCTGCTGTGGGGGATGGAGG + Intergenic
1057336543 9:94160107-94160129 TTGGCTTGTGTGATTTATGGAGG + Intergenic
1203572527 Un_KI270744v1:144341-144363 ATGGTGTCTGTGAGTGAGGGGGG - Intergenic
1186754961 X:12660963-12660985 ATGGCTTCTATATGACATGGTGG + Intronic
1187220804 X:17324001-17324023 AAGGCTTCTTTAAGTCCTGGGGG - Intergenic
1188228911 X:27636827-27636849 ATGGTGCCTGTGTGTCATGGAGG - Intronic
1190895704 X:54615852-54615874 CTGGCTTCTGGGAGTGGTGGTGG - Intergenic
1191649948 X:63526135-63526157 ATAGGTTATGTGTGTCATGGTGG + Intergenic
1192853009 X:74977586-74977608 ATGGCTGCTGTGGGGTATGGGGG + Intergenic
1193423761 X:81316145-81316167 GTGGCTGCTGTGGGTGATGGGGG + Intergenic
1193817540 X:86122155-86122177 ATGGCTGCTGTGGGGGATGGAGG + Intergenic
1194270299 X:91805759-91805781 GAGGCTTCAGTGAGCCATGGTGG + Intronic
1194466212 X:94237689-94237711 GTGGCTGCTGTGAGGGATGGGGG + Intergenic
1194784336 X:98063281-98063303 AAGGCTGCAGTGAGTCATGATGG + Intergenic
1195146821 X:102026618-102026640 ATGGCTTGTGTGTGTCCTGGTGG - Intergenic
1196273431 X:113738633-113738655 ATGGCCTCTGAGAGACATGCTGG + Intergenic
1196456839 X:115896779-115896801 AGGACTCTTGTGAGTCATGGGGG + Intergenic
1197192363 X:123661925-123661947 AAGGCTGCAGTGAGCCATGGTGG + Intronic
1197671658 X:129284400-129284422 GTGGCTGCTGTGGGTGATGGGGG + Intergenic
1198526775 X:137509285-137509307 ATGGCTTCTGTGGGCGATGGGGG + Intergenic
1199802163 X:151262201-151262223 ATGGCTTCAGTGAGTTATTTGGG - Intergenic
1199804242 X:151282097-151282119 ATGGCTTCAGTGAGTTATTTGGG + Intergenic
1200097941 X:153672829-153672851 ATGGCATGTGTGAGTGGTGGTGG - Intronic
1200587534 Y:5027203-5027225 GAGGCTTCAGTGAGCCATGGTGG + Intronic